agricultural chemical methods and compositions for plant control, method of reducing the expression

专利摘要:
agricultural chemical compositions and methods for plant control, method of reducing the expression of a dhps gene in a plant, microbial expression cassette, method of making a polynucleotide, method of identifying polynucleotides useful in modulating the expression of the dhps gene. the present invention relates to compositions for use in improving weed control. specifically, methods and compositions that modulate dihydropteroate synthase in weed species. the present invention also provides combinations of compositions and methods that improve weed control.
公开号:BR112014005954A2
申请号:R112014005954-3
申请日:2012-09-13
公开日:2020-12-01
发明作者:Daniel Ader；John J. Finnessy；Zhaolong Li；Ronak Hasmukh Shah；Nengbing Tao；Christina Marie Taylor；Jennifer Chou Taylor
申请人:Monsanto Technology Llc；
IPC主号:

专利说明:

[001] [001] This claim claims the benefit under 35USC & $ 119 (e) from the United States provisional order serial number 61 / 534,097 filed on 9/13/2011, incorporated in this document by reference, in its entirety. The listing that is contained in the file called "40 21 (58641) B seq listing.txt", which is 513,100 bytes (measured in the MS-Windows operating system) and was created on September 4, 2012, is deposited and incorporated in this document by reference.
[002] [002] Table 1 is provided here as a part of this US patent application through the USPTO EFS system in the file called "40 21 (58641) Btable 1.doxc" which is 39,989 bytes in size (measured in MS -Windows &). Table 1 (file "40 21 (58641) Btable1.doxc" comprises 54 strings and is incorporated here by reference in its entirety.
[003] [003] Table 2 is provided with this as part of this US patent application through the USPTO EFS system in the file called "40 21 (58641) Btable2.doxc" which is 107,841 bytes in size (measured on MS-Windows &). Table 2 (file "40 21 (58641) Btable2.doxc" comprises 848 strings and is incorporated here by reference, in its entirety.
[004] [004] Table 3 is provided with this as part of this US patent application through the USPTO EFS system in the file called "40 21 (58641) Btable3.doxc" which is 21,718 bytes in size (measured in MS- Windows &). Table 3 (file "40 21 (58641)
[005] [005] The methods and compositions generally refer to the field of weed management. More specifically, it refers to 7,8-dihydropterate synthase (DHPS) inhibitory genes in plants and compositions containing polynucleotide molecules to modulate and / or regulate their expression. In addition, useful methods and compositions for weed control are provided. BACKGROUND OF THE INVENTION
[006] [006] Weeds are plants that compete with plants grown in an agronomic environment and cost farmers billions of dollars annually in crop losses and the expense of efforts to keep weeds under control. Weeds also serve as hosts for crop diseases and pests. Damages caused by weeds in agricultural production environments include decreases in crop yield, reduced crop quality, high irrigation costs, high harvest costs, reduced land value, damage to livestock and damage to crops caused by insects and diseases lodged by weeds. The main means by which weeds cause these effects are: 1) to compete with cultivation plants for water, nutrients, sunlight and other essential items for growth and development, 2) production of toxic or irritating chemicals that cause human or animal health problems, 3) production of immense amounts of seeds or vegetative reproductive parts or both that contaminate agricultural products and perpetuate species on agricultural land and 4) production on agricultural and non-agricultural land of large quantities of vegetation - tation that must be discarded. Herbicide-tolerant weeds are a problem with almost all herbicides in use, there is a need for effective management of these weeds. There are more than 365 weed biotypes currently identified as being herbicide resistant to one or more herbicides, the Herbicide Resistance Action Committee (HRAC), the North American Herbicide Resistance Action Committee (NAHRAC) and The Society of Science of
[007] [007] 7,8-dihydropterate synthase (DHPS) inhibitors is an enzyme involved in the synthesis of folic acid, which is necessary for the purine nucleotide biosynthesis. This enzyme is the target of herbicides that include the carbamate chemical family. BRIEF DESCRIPTION OF THE FIGURES
[008] [008] The following figures are part of this descriptive report and are included to further demonstrate certain methods, compositions or results. They can be better understood by reference to one or more of these figures in combination with the detailed description of specific modalities presented here. The invention can be more fully understood from the following description of the figures:
[009] [009] FIGURE 1. Treatment with pools of the oligonucleotide followed by Prowl (pendimethalin)
[010] [010] FIGURE 2. Treatment of Palmer Amaranth with 3 pools of the oligonucleotide, followed by Prowl herbicide at a rate of 12lb / ac SUMMARY
[011] [011] In one aspect, the invention provides a method of plant control comprising an external application to a plant or plant part of a composition comprising a polynucleotide and a transfer agent, wherein the polynucleotide is essentially identical or essentially complementary to a DHPS gene sequence (dihydropterate synthase, DHP or DHPS) or fragment thereof, or to the RNA transcript of said DHPS gene sequence or fragment thereof, in which said DHPS gene sequence is selected from the group formed by SEQ ID nº: 1-54 or a polynucleotide fragment from it. As a result of such application, the plant's growth or development or reproductive capacity is reduced or the plant is made more sensitive to a DHPS-inhibiting herbicide compared to an untreated plant with that composition. In this way, plants that have become resistant to the application of herbicides containing DHPS inhibitor are made more susceptible to herbicide effects, the herbicide, thus, potentiating the effect of herbicides. The polynucleotide fragment is at least 18 contiguous nucleotides, at least 19 contiguous nucleotides, at least 20 contiguous nucleotides or at least 21 contiguous nucleotides in length and at least 85 percent identical to a sequence of the DHPS gene selected from the group consisting of the group SEQ ID NO: 1-54 and the transfer agent comprises an organosilicone composition or compound. The polynucleotide fragment can also be ssDNA or ssRNA, dsRNA, or dsDNA or sense or antisense AsDNA / RNA hybrids. The composition may include various components that include more than one polynucleotide fragment, a DHPS-inhibiting herbicide and / or other herbicides that increase the plant's control activity of the composition.
[012] [012] In another aspect, polynucleotide molecules and methods for modulating DHPS gene expression in a plant species are provided. The method reduces, suppresses or otherwise retains the expression of a DHPS gene in a plant comprising an application external to that plant of a composition comprising a polynucleotide and a transfer agent, in which the polynucleotide is essentially identical or essentially complementary to a DHPS gene sequence or fragment thereof, or to the RNA transcript of the DHPS gene sequence or fragment thereof, where the DHPS gene sequence is selected from the group consisting of SEQ ID No.: 1-54 or a polynucleotide fragment thereof. The polynucleotide fragment is at least 18 contiguous nucleotides, at least 19 contiguous nucleotides, at least 20 contiguous nucleotides or at least 21 contiguous nucleotides in length and at least 85 percent identical to a DHPS gene sequence selected from the group consisting of the group SEQ ID No.: 1-54 and the transfer agent is an organosilicone compound. The polynucleotide fragment can also be ssDNA or ssRNA, dsRNA, or dsDNA or hybrids of sense or antisense dsDNA / RNA. Polynucleotide molecules comprising SEQ ID NOs 55-1175 are fragments of the DHPS gene.
[013] [013] In an additional aspect, the polynucleotide molecule composition can be combined with other herbicidal compounds to provide additional control of unwanted plants in a field of cultivated plants.
[014] [014] In an additional aspect, the composition of the polynucleotide molecule can be combined with any one or more additional agricultural chemicals, such as insecticides, fungicides, nematocides, bactericides, acaricides, growth regulators, chemotherapy rilizers, semi-chemicals, repellents, attractants, pheromones, food stimulants, biopesticides, microbial pesticides or other biologically active compounds to form a multi-component pesticide giving an even broader spectrum of agricultural protection. DETAILED DESCRIPTION
[015] [015] Methods and compositions containing a polynucleotide are provided that provide for the regulation, repression or delay of expression of the 7, 8-dihydropteroate synthase (DHPS) gene and improved control of plant species with weeds and herb biotypes. weeds resistant to the DHPS inhibitor. Aspects of the method can be applied to manage various weed plants in agronomic and other cultivated environments.
[016] [016] The following definitions and methods are provided to further define the present invention and to guide those ordinarily skilled in the art. Unless otherwise indicated, the terms must be understood in accordance with conventional usage by those of ordinary skill in the relevant technique. Where a term is provided in the singular, the inventors also contemplate aspects described by the plural of that term.
[017] [017] By "unable to transcribe" polynucleotides means that polynucleotides do not comprise a complete polymerase | l transcription unit.
[018] [018] As used here, "solution" refers to homogeneous and non-homogeneous mixtures such as suspensions, colloids, micelles and emulsions.
[019] [019] Weed plants are plants that compete with cultivated plants, those of particular importance include, but are not limited to, the important harmful and invasive weeds and biotypes resistant to herbicide from crop production, such as, Amaranthus species -THE. albus, A. blitoides, A. hybridus, A. palmeri, A. powellii, A. retroflexus, A. spinosus, A. tuberculatus, and A.viridis, Ambrosia species - A. trifida, A. artemisifolia; Lolium species - L. multiflorum, L. rigidium, L perenne; Digitaria species -D. insularis; Euphorbia species -E. heterophylla; Kochia species - K. scoparia; Sorghum species -S. halepense; Conyzaspecies -C. bonariensis, C. canasensis, C. sumatrensis; Chloris species -C. truncate; Echinochola speecies - E. colona, E.crus-galli; Eleusine species -E. indicates; Poa species - P. annua; Plantago species -P. lanceolata; Avena species - A. fatu- a; Chenopodium species - C. album; Setaria species - S. viridis, Abutilon theophrasti, Ipomoea species, Sesbania, species, Cassia species, Sida species, Brachiaria, species and Solanum species.
[020] [020] Species of weed plants found in cultivated areas includeA / opecurus Alopecurus, Avena sterilis, Avena steríilis ludoviciana, Brachiariaplantaginea, Bromus diandrus, Bromus rigidus, Cynosurus echinatus, Digitaria ciliaris, Digitaria ischaemum, , Eriochloa punctata, Hordeum glaucum, Hordeum leporinum, Ischemum rugosum, Leptochloa chinensis, Lolium persicum,, Phalaris mini, Phalaris paradoxa, Rottboellia exalta, Setaria faberi, Setaria viridis var, robusta-alba schreiber, robusta-alba schreiber, -purpurea, Snowdenia polystachea, Sorghum sudanese, Alisma plantago-aquatica, Amaranthus lividus, Amaranthus quitensis, Ammania auricu- lata, Ammaniacoccinea, Anthemis cotula, Apera spica-venti, Bacopa rotundifolia, Bidens pilosa, Bidens subalromortans, Brassica tournum Camelinamicrocarpa, Chrysanthemum coronarium, Cuscuta campestris, Cyperus difformis, Damasonium minus , Descurainaria sophia, Diplotaxis tenuifolia, Echiumplantagineum, Elatine triandra var, pedicellata, Euphorbia heterophylla, Fallopia convolvulus, Fimbristylis miliacea, Galeopsis tetrahit, Galium spurium, Helianthus an- nuus, Iva xanthifom, Iva xanthifolia, Iva xanthifolia, IX , Ipomoea sepiaria, Ipomoea aquatic, Ipomoea triloba, Lactuccaserriola, Limnocharis flava, Limnophila erecta, Limnophila sessilifloora, Lindernia dubia, Lindernia dubia var, major, Lindernia micrantha, Linderniaprocumbens, Mesembryanthemisia korea, Monochoria, korea, monocrykia , Papaver rhoeas, Partheniumhysterophorus, Pentzia suffruticosa, Phalaris minor, Raphanus raphanistrum, Raphanus sativus, Rapistrum rugosum, Rotala indica var, uliginosa, Sagittaria gquyanensis, Sagittaria montevidensis, Sagittaria pygmaea, Scittpyrususis, var. Setarialutescens, Sida spinosa, Sinapis arvensis, Sisymbrium orient ale, Sisymbrium thellungii ,, Solanum ptycanthum, Sonchus asper, Sonchus oleraceus, Sorghum bicolor, Stellaria media, Thlaspi arvense, Xanthium strumarium, Arctotheca calendula, Conyza sumatrensis, Crassocephalum crepidiodes, Cuphea carthagenen
[021] [021] Some cultivated plants can also be weed plants when they occur in unwanted environments. For example, corn plants growing in a soybean field. Transgenic crops with tolerances to one or more herbicides will need specialized management methods to control voluntary weeds and crop plants.
[022] [022] A "trigger" or "trigger polynucleotide" is a polynucleotide molecule that is homologous or complementary to a polynucleotide of the target gene. The triggering polynucleotide molecules modulate the expression of the target gene when applied topically to a plant surface with a transfer agent, whereby a plant treated with that composition has its regular growth or development or reproductive capacity.
[023] [023] It is contemplated that the compositions will contain one or more polynucleotides and one or more herbicides that include, but are not limited to, polynucleotides triggering the DHPS gene and a DHPS inhibiting herbicide and any one or more polynucleotides additional herbicide target gene splicers and related herbicides and any one or more additional essential gene triggering polynucleotides. Essential genes are genes in a plant that provide key enzymes or other proteins, for example, a biosynthetic enzyme, metabolizing enzyme, receptor, signal transduction protein, structural gene product, transcription factor or transport protein; or regulatory RNAs, such as microRNAs, which are essential for the growth or survival of the organism or cell or involved in normal plant growth and development (Meinke, et al., Trends Plant Sci. 2008 Sep; 13 (9): 483-91). The suppression of an essential gene increases the effect of an herbicide that affects the function of a gene product other than the deleted essential gene. The compositions can include several triggering polylucleotides that modulate the expression of an essential gene other than DHPS.
[024] [024] Herbicides for which transgenes for plant tolerance have been demonstrated, include but are not limited to: auxin, glyphosate, glufosinate, sulfonylureas, imidazolinones, bromoxynil, delapon, dicamba, cyclohezanodione inhibitors, oxidase protoporphyronogen inhibitors , 4-hydroxyphenyl-pyruvate-dioxigenase inhibiting herbicides. For example, transgenes and their polynucleotide molecules
[025] [025] DHPS inhibitor herbicides include, but are not limited to, carbamates and asulam. Mitosis inhibitor herbicides include but are not limited to dinitroaniline herbicides for example bentfluralin, butralin, dinitramine, ethalfluralin, orizaline, pendimethalin and trifluralin. Additional mitosis inhibitor herbicides also include but are not limited to Phosphoramidate acids,
[026] [026] Numerous herbicides with similar or different modes of action (referred to herein as co-herbicides) are available that can be added to the compositions, for example, members of herbicide families that include but are not limited to amide herbicides, aromatic acid herbicides, arsenic herbicides, benzothiazole herbicides, benzoylcyclohexanedione herbicides, benzofuranyl alkylsulfonate herbicides, carbamate herbicides, cyclohexene oxime herbicides, cyclopropylisoxazine herbicides, dinicide herbicides, dichloride herbicides, dichloride killers dinitrophenol, diphenyl ether herbicides, dithiocarbamate herbicides, aliphatic halogenate herbicides, imidazolinone herbicides, inorganic herbicides, nitrile herbicides, organophosphorus herbicides, oxadiazolone herbicides, oxazole herbicides, phenicolide herbicides, phenicolide herbicides, pyrazole herbicides, pyridazine herbicides, pyridazin herbicides ona, pyridine herbicides, pyrimidine diamine herbicides, pyrimidinyloxybenzylamine herbicides, quaternary ammonium herbicides, thiocarbamate herbicides, thiocarbonate herbicides, thiourea herbicides, triazine herbicides, triazine herbicides, triazine herbicides, triazine herbicides, triazide herbicides, triazide herbicides triazolopimimidine, uracil herbicides, and urea herbicides. In particular, usage rates for added herbicides can be reduced in compositions comprising the polynucleotides. Reductions in the use rate of additional added herbicides can be 10-25 percent, 26-50 percent, 51-75 percent or more can be achieved that increase polynucleotide activity and herbicide composition and contemplated. Co-herbicides representing households include, but are not limited to, acetochlor, acifluorphene, acifluorphenone-sodium, aclonifene, acrolein, alacloor, aloxidim, allyl alcohol, amine, amicarbazone, amidosulfuron, aminopyralid, amitrol, ammonium sulfamate, anilof asulam, atraton, atrazine, azimsulfuron, BCPC, be-flubutamide, benazoline, benfluralin, benfuresate, bensulfuron, ben-sulfuron-methyl, bensulide, bentazone, benzfendizone, benzobicyclon, benzofenap, bifenox, bilanafos, bispiribac, bispiribac, bispiribac, bispiribac, bispiribac, bromacil, bromobutide, bromoxynil, butachlor, butafenacil, butamiphos, butralin, butroxidim, butylate, cacodylic acid, calcium chlorate, cafenstrol, carbetamide, carfentrazone, carfentrazone-ethyl, CDEA, CEPC, chlor-fluorenol, chlor-fluurenol, chlor-fluorenol , chlorimuron, chlorimuron-ethyl, chloroacetic acid, chlorotoluron, chlorprofam, chlorsulfuron, clortal, clortal-dimethyl, cinidon-ethyl, cinmetilina, cinosulfuron, cisanilide, cletodim, clodinafop, clodinafo p-propargyl, clomazone, clomeprop, clopyralid, chloran-sulam, cloransulam-methyl, CMA, 4-CPB, CPMF, 4-CPP, CPPC, cresol, cumiluron, cyanamide, cyanazine, cyclate, cyclosulfamuron, cycloxidine, cihalofop, cihalopop, cihalopop butyl, 2, 4-D, 3, 4-DA, daimuron, dalapon, dazomet, 2, 4-DB, 3, 4-DB, 2, 4-DEB, demedifam, dicamba, diclobenil, orthodichlorobenzene, para- dichlorobenzene, dichlorprop, dichlorprop-P, diclofop, diclofop-methyl, diclosulam, difenzoquat, difenzoquat methylsulfate, diflufenican, diflufenzopyr, dimefuron, dimepiperate, dimetachlor, dime-tametrin, dimethine, dimethine, dimethamide, dimethamide, dimethamide, dimethamide, dimethine, dimethamide, dimethamide, dimethine, dimethyramide dinitramine, dinoterb, diphenamide, diquat, diquat dibromide, dithiopyr, diuron, DNOC, 3, 4-DP, DSMA, EBEP, endotal, EPTC, esprocarb, etalfluraline, etametsulfuron, etametsulfuron-methyl, etofumesate, ethoxy sulfur, , etobenzanid, fenoxaprop-P, phenoxaprop-P-ethyl, fen- traamide, ferrous sulfate, flamprop-M, flazasulfuron, florasulam, fluazifop, fluazifop-butyl, fluazifop-P, fluazifop-P-butyl, flucarbazone, flucarba-zone-sodium, flucetosulfuron, flucloralin, flufenacet, flufenpir, flufenpirethyl, lumetsulam, flumiclorac, flumichlorac-pentyl, lumioxazine, fluoroglycoril, fluometogluorone flupropanate, flupirsulfuron, flupirsulfuron-methyl-sodium, flurenol, fluridone, fluorochloridone, fluoroxypyr, flurtamone, flutiacet, flutiacet-methyl, fomesafen, foramsulfuron, fosa-
[027] [027] An agronomic field in need of plant control is treated by applying the composition directly to the surface of growing plants, such as by spray. For example, the method is applied to control weeds in a field of crop plants by spraying the field with the compost. The composition can be provided as a tank mix, a sequential treatment of components (usually the composition containing polynucleotide followed by the herbicide), or a simultaneous treatment or mixing of one or more of the components of the composition from separate containers . Field treatment can occur as often as necessary to provide weed control and composition components can be adjusted for species with specific target weeds or weed families through the use of specific polynucleotides or capable polynucleotide compositions to selectively target the specific species or plant family to be controlled. The composition can be applied at effective utilization rates according to the time of application to the field, for example, pre-planting, at planting, post-planting, post-harvest. DHPS-inhibiting herbicides can be applied to a field at rates of 500 to 3000 g ai / ha (active ingredient per hectare) or more. Polynucleotides in the composition can be applied at rates of 1 to grams per acre depending on the number of trigger molecules needed for the scope of weeds in the field.
[028] [028] Cultivation plants where weed control is necessary include, but are not limited to, i) corn, soybeans, cotton, canola, beets, alfalfa, sugar cane, rice and wheat; ii) vegetable plants including, but not limited to, tomato, peppers, pepper, melon, watermelon, cucumber, eggplant, cauliflower, broccoli, lettuce, spinach, onion, peas, carrots, sweet corn, Chinese cabbage , leeks, fungi, strawberry, pumpkin (squash or gourd), radish, Brussels sprouts, tomato, garden beans, dried beans or okra; iii) culinary plants, including, but not limited to, basil, parsley, coffee or tea; or, iv) fruit plants, including but not limited to apple, pear, cherry, peach, plum, apricot, banana, plantain, table grape, wine grape, citrus, avocado, mango or berry; v) a tree grown for ornamental or commercial use, including, but not limited to, a fruit or nut tree; or vi) an ornamental plant (eg, an ornamental plant or shrub or grass grass). The methods and compositions provided here can also be applied to plants produced by a process of cutting, cloning, or grafting (ie, a plant not cultivated from a seed) include plants and fruit trees which include, but are not limited to, citruses, apples, avocados, tomatoes, eggplants, cucumbers, melons, watermelons and grapes, as well as various ornamental plants. Pesticide Mixtures
[029] [029] Polynucleotide compositions can also be used as mixtures with various agricultural chemicals and / or insecticides, acaricides and fungicides, pesticides and biopesticides. Examples include but are not limited to azinphos-methyl, acephate, isoxation, isophenphos, etion, etrimphos, oxidemeton-methyl, oxideprofos, quinalfos, chlorpyrifos, chlorpyrifos-methyl, chlorfenvinfos, cyanofos, dioxa-
[030] [030] As used herein, the term "DNA", "DNA molecule", "DNA polynucleotide molecule" refers to a single-stranded DNA (SSDNA) or double-stranded DNA molecule (dsDNA) from genomic or synthetic origin, such as, a deoxyribonucleotide base polymer or a DNA polynucleotide molecule. As used herein, the term "DNA sequence", "DNA nucleotide sequence" or "DNA polynucleotide sequence" refers to the nucleotide sequence of a DNA molecule. As used herein, the term "RNA", "RNA molecule", "RNA polynucleotide molecule" refers to a single-stranded RNA (SSRNA) or double-stranded RNA (dsRNA) molecule of genomic origin or synthetic, such as, a polymer of ribonucleotide bases comprising single or double strand regions. Unless otherwise stated, nucleotide sequences in the text of this specification
[031] [031] As used here, "polynucleotide" refers to a DNA or RNA molecule that contains multiple nucleotides and generally refers to "oligonucleotides" (a polynucleotide molecule of normally 50 nucleotides or less in length) and polynucleotides of 51 or more nucleotides. Modalities include compositions including oligonucleotides, having a length of 18-25 nucleotides (18-mers, 19-mers, 20-mers, 21-mers, 22-mers, 23-mers, 24-mers or 25-mers), for example, oligonucleotides from table 3 (SEQ ID No: 907-1175) for respective fragments or polynucleotides of medium length, with a length of 26 or more nucleotides (polynucleotides of 26, 27, 28, 29, 30, 39, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 39, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 210, about 220, about 230, about 240, about 250, about 260, about 270, about 280, about 290, or about 300 nucleotides), for example, polynucleotides from table 2 (SEQ ID NO: 55-906) or their fractions long segments or polynucleotides with a length greater than about 300 nucleotides (for example, polynucleotides of between about 300 to about 400 nucleotides, between about 400 to about 500 nucleotides, between about 500 to about 600 nucleotides, between about 600 to about 700 nucleotides, between about 700 to about 800 nucleotides, between about 800 to about 900 nucleotides
[032] [032] Polynucleotide compositions used in the various modalities include compositions including oligonucleotides or polynucleotides or a mixture of both, including hybrids of RNA or DNA or RNA / DNA or chemically modified oligonucleotides or polynucleotides or a mixture thereof. In some embodiments, the polynucleotide may be a combination of ribonucleotides and de-
[033] [033] Polynucleotides can be single-stranded or double-stranded RNA or single or double-stranded DNA or hybrid double-stranded DNA / RNA or modified analogs thereof, and may be of oligonucleotide lengths or greater. In more specific embodiments, the polynucleotides that provide single-stranded RNA in the plant cell are selected from the group consisting of (a) a single-stranded RNA molecule (ssSRNA), (b) a single-stranded RNA molecule that self-hybridizes to form a double-stranded RNA molecule, (c) a double-stranded RNA (dsRNA) molecule, (d) a single-stranded DNA molecule (sSDNA), (e) a single-stranded DNA molecule that self hybridizes to form a double-stranded DNA molecule, and (f) a single-stranded DNA molecule including a modified Pol Ill gene that is transcribed to an RNA molecule, (g) a double-stranded DNA molecule (dsDNA) , (h) a double-stranded DNA molecule including a modified Pol Ill gene that is transcribed into an RNA molecule, (i) a double-stranded hybridized RNA / DNA molecule, or combinations thereof.
[034] [034] The term "gene" refers to components comprising chromosomal DNA, plasmid DNA, cDNA, intron and exon DNA, artificial DNA polynucleotide or other DNA encoding a peptide, polypeptide, protein, or RNA transcript molecule and the genetic elements that flank the coding sequence that are involved in the regulation of expression, such as promoter regions, leader 5 'regions, untranslated 3' region that may exist as native genes or transgenes in a plant genome. The gene or a fragment thereof is isolated and subjected to polynucleotide sequencing methods that determine the order of the nucleotides that comprise the gene. Any of the gene's components are potential targets for a triggering oligonucleotide and polynucleotides.
[035] [035] The triggering polynucleotide molecules are designed to modulate expression by inducing the regulation or suppression of an endogenous DHPS gene in a plant and are designed to have a nucleotide sequence essentially identical or essentially complementary to the sequence of nucleotides from an endogenous DHPS gene from a plant or the RNA sequence transcribed from an endogenous DHPS gene from a plant, including a transgene in a plant that provides for a herbicide resistant DHPS enzyme, which can be a coding sequence or non-coding sequence. Effective molecules that modulate expression are referred to as "a triggering molecule, or triggering polynucleotides". By "essentially identical" or "essentially complementary" is meant that the triggering polynucleotides (or at least one strand of a double-stranded polynucleotide or portion thereof, or a portion of a single-stranded polynucleotide) are designed to hybridize to the non-coding sequence of the endogenous gene or to the transcribed RNA (known as messenger RNA or an RNA transcript) from the endogenous gene for the purpose of regulating or suppressing the expression of the endogenous gene. Triggering molecules are identified by "tiling" gene targets with partially overlapping probes or non-overlapping sense or antisense polynucleotide probes that are essentially identical or essentially complementary to the nucleotide sequence of an endogenous gene. Multiple target sequences can be aligned and sequence regions with common homology are identified as potential triggering molecules for multiple targets. Several triggering molecules of various lengths, for example 18-25 nucleotides, 26-50 nucleotides, 51-100 nucleotides, 101-200 nucleotides, 201-300 nucleotides or more can be pooled in some treatments to investigate polynucleotide molecules that cover a portion of a gene sequence (for example, a portion of a coding versus a portion of a non-coding region, or a 5 'versus a 3' portion of a gene) or an entire gene sequence including regions coding and non-coding of a target gene. Polynucleotide molecules of the triggered molecules subjected to the pool can be divided into smaller pools or simple molecules to identify trigger molecules that provide the desired effect.
[036] [036] The RNA and DNA polynucleotide molecules of the target gene (Table 1, SEQ ID NO: 1-54) are sequenced by any number of available equipment and methods. Some of the sequencing technologies are commercially available, such as Affíymetrix Inc.'s sequencing-by-hybridization platform (Sunnyvale, California) and sequencing-by-hybrid platforms.
[037] [037] Functional single-strand polynucleotide modalities have sequence complementarity that need not be 100 percent, but that is at least sufficient to allow hybridization to RNA transcribed from the target gene or DNA of the target gene for form a duplex to allow a gene silencing mechanism. Thus, in embodiments, a polynucleotide fragment is designed to be essentially identical to, or essentially complementary to, a sequence of 18 or more contiguous nucleotides or in the target DHPS gene or messenger RNA transcribed from the target gene . By "essentially identical" is meant to have 100 percent sequence identity or at least about 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence identity when compared to the sequence of 18 or more contiguous nucleotides either in the target gene or in the transcribed RNA of the target gene; by "essentially complementary" is meant to have 100 percent sequence complementarity or at least about 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence complementarity when compared to the sequence of 18 or more contiguous nucleotides in the target gene or in the RNA transcribed from the target gene. In some embodiments, polynucleotide molecules are designed to have 100 percent sequence identity with or complementary to an allele or family member of a given target gene (a gene's coding or non-coding sequence); in other embodiments, polynucleotide molecules are designed to have 100 percent sequence identity with or complementarity to multiple alleles or family members of a given target gene. The polynucleotide sequences triggered in the sequence listing SEQ ID NO: 1- 1222 or table 1, 2 or 3 perhaps complementary or homologous to a portion of the DHPS target gene sequence.
[038] [038] In certain embodiments, the polynucleotides used in the compositions that are essentially identical or essentially complementary to the target gene or transcript will comprise the predominant nucleic acid in the composition. Thus, in certain embodiments, polynucleotides that are essentially identical or essentially complementary to the target gene or transcript will comprise at least about 50%, 75%, 95%, 98% or 100% of the nucleic acids provided in the composition in molar or mass concentration. However, in certain embodiments, polynucleotides that are essentially identical or essentially complementary to the target gene or transcript can comprise at least about 1% to about 50%, about 10% to about 50%, about 20 % to about 50%, or about 30% to about 50% of the nucleic acids provided in the composition
[039] [039] "Identity" refers to the degree of similarity between two polynucleic acid or protein sequences. An alignment of two sequences is carried out by an appropriate computer program. A widely used and accepted computer program for performing sequence alignments is CLUSTALW v
[040] [040] Triggering molecules for members of the specific gene family can be identified from coding and / or non-coding sequences of gene families of a plant or multiple plants, aligning and selecting 200-300 poly fragments
[041] [041] Molecules triggering broad activity can be identified from coding and / or non-coding sequences of gene families from one plant or several plants, aligning and selecting 200-300 polynucleotide fragments from the most homologous regions among the sequences aligned and evaluated using topically applied polynucleotides (such as SssSDNA or ssRNA sense or antisense, dsRNA, or dsDNA) to determine their relative effectiveness in inducing the yield / quality phenotype. The effective segments are subdivided into 50-60 polynucleotide fragments, prioritized by more homology, and reevaluated using topically applied polynucleotides. The 50-60 effective polynucleotide fragments are subdivided into 19-30 polynucleotide fragments, prioritized by more homology and evaluated again to induce the yield / quality phenotype. Once the relative effectiveness is determined, the fragments can be used alone, or in combination with one or more other fragments to determine the triggering composition or mixture of disruptive polynucleotides to provide the performance / quality phenotype.
[042] [042] Methods of making polynucleotides are well known in the art. Chemical synthesis, in vivo synthesis and in vitro synthesis methods and compositions are known in the art and include various viral elements, microbial cells, modified polymerases and modified nucleotides. Commercial preparation of oligonucleotides often provides two deoxyribonucleotides at the 3 'end of the sense filament. Long polynucleotide molecules can be synthesized from commercially available kits, for example, Applied Biosystems / Ambion kits (Austin, TX) have DNA bound at the 5 'end in a microbial expression cassette that includes a promoter of bacterial T7 polymerase that makes filamentary RNA that can be mounted on a dsRNA and kits provided by several manufacturers that include T7 RiboMax Express (PromegaMadison, WI), AmpliScribe T7-Flash (epicenter, Madison, WI) and TranscriptAid T7 High Yeld (Fermens, Glen Burnie, MD). DsRNA molecules can be produced from microbial expression cassettes in bacterial cells (Ongvarrasopone et al. ScienceAsia 33: 35-39; Yin, Appl. Microbiol. Biotechnol 84: 323-333, 2009; Liu et al, BMC Biotechnology 10:85, 2010) that have regulated or deficient RNase Ill enzyme activity or the use of multiple viral vectors to produce sufficient amounts of dsR-NA. DHPS gene fragments are inserted into the microbial expression cassettes in a position where the fragments are expressed to produce sSRNA or dsRNA useful in the methods described in this document for regulating the expression of a target DHPS gene. Long polynucleotide molecules can also be assembled from multiple fragments of RNA or DNA. In some modalities, design parameters, such as Reynolds classification
[043] [043] Polynucleotide compositions are useful in compositions, such as solutions of polynucleotide molecules, in low concentrations, isolated or in combination with other components in the same solution or in separately applied solutions that provide an enhancement agent. permeability. Although there is no upper limit on the concentrations and dosages of polynucleotide molecules that can be useful in the methods, lower effective doses and concentrations will generally be sought for efficiency. The concentrations can be adjusted taking into account the volume of spray or treatment applied to the leaves of plants or other surfaces of part of plants, such as flower petals, stems, tubers, fruits, anthers, pollen or seed. In one embodiment, a useful treatment for herbaceous plants using 25-mer oligonucleotide molecules is about 1 nanomol (nmol) of oligonucleotide molecules per plant, for example, from about 0.05 to 1 nmol per plant. Other embodiments for herbaceous plants include useful ranges of about 0.05 to about 100 nmol, or about 0.1 to about 20 nmol, or about 1 nmol to about 10 nmol of polynucleotides per plant. Very large plants, trees or vines may require correspondingly greater amounts of polynucleotides. When using long dsRNA molecules that can be processed into multiple oligonucleotides, lower concentrations can be used. To illustrate modalities, factor 1X, when applied to oligonucleotide molecules, is arbitrarily used to denote a treatment of 0.8 nmol polynucleotide molecule per plant; 10X, 8 nmol of polynucleotide molecule per plant; and 100X, 80 nmol of polynucleotide molecule per plant.
[044] [044] The triggering polynucleotide and oligonucleotide molecule compositions are useful compositions in the compositions, such as liquids that comprise these polynucleotide molecules, alone or in combination with other components, for example one or more herbicide molecules or in the same liquid or in separately applied liquids that also provide a transfer agent. As used in this document, a transfer agent is an agent that, when combined with a polynucleotide in a composition that is applied topically to a target plant surface, allows the polynucleotide to enter a plant cell. In certain embodiments, a transfer agent is an agent that conditions the surface of the plant tissue, e.g. eg, leaves, stems, roots, flowers or fruits, to permeation by polynucleotide molecules in plant cells. The transfer of polynucleotides in plant cells can be facilitated by the earlier or contemporary application of a polynucleotide transfer agent to plant tissue. In some embodiments, the transfer agent is applied after application of the polynucleotide composition.
[045] [045] Ligands can be tied to a polynucleotide, for example a dsRNA, ssRNA, dsDNA or ssDNA. Binders in general may include modifiers, for example, for reinforcement absorption; diagnostic compounds or reporter groups, for example, to monitor distribution; crosslinking agents; fractions that confer nuclease resistance; and natural or unusual nucleobases. General examples include lipophiles, lipids (for example, cholesterol, a bile acid, or a fatty acid (for example, lithocholic oleyl, lauroyl, docosrnil, estearoil, palmitoil, miristoil oleoil, linoleoil), steroids (for example, uvaol , hecigenin, diosgenin), terpenes (eg, triterpenes, eg, sarsasapogenin, Friedelin, lithocholic acid derived from epifri-edelanol), vitamins (eg, folic acid, vitamin A, biotin, pyridoxal), carbohydrates, proteins , protein binding agents, integrin targeting molecules, polycationic, peptides, polyamines and peptide imitation.The linker can also be a recombinant or synthetic molecule, such as a synthetic polymer, for example , polyethylene glycol (PEG), PEG -40K, PEG -20K and PEG -5K Other examples of binders include lipophilic molecules, for example, cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone , glycerol (for example, is esters and ethers thereof, for example, C.sub.10, C.sub.11, C.sub.12, C.sub.13, C.sub.14, C.sub.15, C.sub.16 , C.sub.17, C.sub.18, C.sub.19, or C.sub.20 alkyl; for example, lauroyl docosnil, stearoyl, oleoyl, linoleoyl 1, 3-bis-O (hexadecyl) glycerol, 1,3-bis-O (octaadecyl) glycerol), ge raniloxyhexyl, hexadecylglycer |, borneol, menthol, 1, 3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3- (oleoyl) lithocholic acid, O3- (oleoyl) cholic acid, dodecanoyl, litocolyl, 5.beta.-cholanyl, N, N-distearyl-litocolamide, 1, 2-di-O-stearoylglyceride, dimethoxytrityl, or phenoxyazine) and PEG (for example, PEG-5K, PEG-20K, PEG-40K). Preferred lipophilic fractions include lipid residues, cholesteryl, oleyl, retinyl or cholesteryl.
[046] [046] Conjugating a ligand to a dsRNA can improve its cellular absorption, lipophilic compounds that have been conjugated to oligonucleotides include 1-pyrene butyric acid, 1,3-bis-O- (hexadecyl) glycerol and menthol. An example of a ligand for receptor-mediated endocytosis is folic acid. Folic acid enters the cell by endocytosis irradiated by folate receptor. Compounds of dsRNA carrying folic acid could be efficiently transported within the cell through folate receptor-mediated endocytosis. Other binders that have been conjugated to oligonucleotides include polyethylene glycols, carbohydrate clusters, crosslinking agents, porphyrin conjugates, delivery peptides and lipids such as cholesterol. In certain cases, conjugation of a cationic ligand to oligonucleotides results in improved resistance to nucleases. Representative examples of cationic ligands are propylammonium and dimethylpropylammonium. The antisense oligonucleotides have been reported to retain their high binding affinity for MRNA when the cationic ligand has been dispersed along the oligonucleotide. See M. Manoharan Ran Antisense & Nucleic Acid Drug Development 2002, 12, 103 and reference
[047] [047] A biological delivery can be performed by a variety of methods, including, without limitation, (1) loading liposomes with a dsRNA acid molecule provided here and (2) complexing a dsRNA molecule with lipids or liposomes to form lipid-nucleic acid complexes or nucleic acid liposome. The liposome may be composed of cationic and neutral lipids, commonly used to transfect cells in vitro. Cationic lipids can complex (for example, charge-associate) with negatively charged nucleic acids to form liposomes. Examples of cationic liposomes include, without limitation, lipofectin, lipofectamine, lipofectace and DO-TAP. Procedures for the formation of liposomes are well known in the art. Compositions of liposomes can be formed, for example, from phosphatidylcholine, dimiristoyl phosphatidylcholine, dipalmitoyl phosphatidylcholine, dimiristoyl phosphatidyl glycerol, dioleoyl phosphatidylethanolamine or liposomes comprising dihydrosphingomyelin (DHSM) are commercially available. (Invitrogen / Life Technologies, Carlsbad, Calif.) And Effectene TM (Qiagen, Valencia, California), in addition, systemic delivery methods can be optimized using commercially available cationic lipids such as DDAB or DOTAP, each of which it can be mixed with a neutral lipid such as DOPE or cholesterol. In some attenuations, liposomes like those described by Templeton et al. Nature Biotechnology, 15: 647-652 (1997) can be used. In other embodiments, polycations such as polyethyleneimine can be used to achieve in vivo and ex vivo delivery (Boletta et al, J. Am Soc. Nephrol. 7: 1728, 1996). Additional information on the use of liposomes to deliver nucleic acids can be found in U.S. Pat. US No. 6,271,359, PCT publication WO 96/40964 and Morrissey, D. et al., 2005. Nature Biotechnol. 23 (8): 1002-7.
[048] [048] In certain embodiments, an organosilicon preparation that is commercially available as a surfactant SilwetO L-77, having CAS number 27306-78-1 and EPA number: CAL.REG.NO. 5905-50073-AA, and currently available from Momentive Performance Materials, Albany, New York, can be used to prepare a polynucleotide composition. In certain embodiments where a Silwet L-77 organosilicone preparation is used as a pre-spray treatment for plant leaves or other plant surfaces, newly made concentrations in the range of about 0.015 to about 2 percent in weight (weight percentage) (eg, about 0, 01, 0, 015, O, 02, O, 025, O, 03, O, 035, O, 04, O, 045, O, O5, O, 055 , O, 06, O, 065, O, 07, O, 075, O, 08, O, 085, O, O9, O, 095, O, 1, 0, 2, 0, 3,0,4,0 , 5,0,6,0, 7, 0,8, 0,9,1,0,1,1,1,2,1,3,1,4,1,5,1,6,1,7 , 1,8,1,9,2,0,2, 1, 2, 2, 2, 3, 2, 5% by weight) are effective in the preparation of a leaf or other plant surface for the transfer of polynu- cleotides in plant cells from topical application to the surface. In certain modalities of methods and compositions provided herein, a composition comprising a poly-nucleotide molecule and an organosilicone preparation comprising Silwet L-77 in the range of about 0.015 to about 2% by weight (weight percentage) ) (eg, 0, 01, 0, 015, O, 02, O, 025, O, 03, O, 035, O, 04, O, 045, O, O5, O, 055, O, 06, O, 065, O, 07, O, 075, O, 08, O, 085, O, O9, O, 0950, 1, O, 2, O, 3, 0, 4, O, 5, O, 6, 0, 7, 0, 8, 0, 9, 1, 0, 1, 1, 1.2, 1.3, 1,4,1,5,1,6,1,7,1,8,1,9, 2,0,2,1,2,2,2,3,2, 5% by weight) are used or provided.
[049] [049] In certain embodiments, any of the commercially available organosilicone preparations provided as follows Breakthru S 321, Breakthru S 200 Cattt 67674-67-3, Breakthru OE 441 Cattt68937-55-3, Breakthru S 278 Cat 427306-78- 1, Breakthru S 243, Breakthru S 233 Catft134180-76-0, available from the manufacturer Evonik
[050] [050] Organosilicon preparations used in the methods and compositions provided herein may comprise one or more effective organosilicone compounds. As used here, the phrase "effective organosilicon compound" is used to describe any organosilicon compound found in an organosilicon preparation that allows a polynucleotide to enter a plant cell. In certain embodiments, an effective organosilicone compound can enable a polynucleotide to enter a plant cell in a way that allows polynucleotide-mediated suppression of the expression of a target gene in the plant cell. In general, effective organosilicone compounds include, but are not limited to, compounds that may comprise: i) a trisiloxane head group that is covalently linked to, ii) an alkyl linker, including, but not limited to, an n-propyl linker, which is covalently attached to, (ii) a polyglycol chain, which is covalently attached to, iv) a terminal group. Trisiloxane head groups of such effective organosilicon compounds include, but are not limited to, heptamethyltrisiloxane. Alkyl linkers can include, but are not limited to, an n-propyl linker. Poly glycol chains include, but are not limited to, polyethylene glycol or polypropylene glycol. Poly glycol chains can comprise a mixture that provides an average chain length "n" of about "7, 5". In certain embodiments, the average chain length "n" can vary from about 5 to about 14. End groups can include, but are not limited to, alkyl groups, such as a methyl group. Effective organosilicone compounds are believed to include, but are not limited to, trisyloxane ethoxylate surfactants or polyalkylene oxide modified heptamethyl trisiloxane. Sã Deo TIS>
[051] [051] (Compound |: heptamethyltrisiloxane polyalkylene oxide, mean n = 7.5).
[052] [052] In certain embodiments, an organosilicon preparation comprising an organosilicon compound comprising a trisiloxane head group is used in the methods and compositions provided in this document. In certain embodiments, an organosilicone preparation comprising an organosilicone compound comprising a heptamethyltrisiloxane head group is used in the methods and compositions provided herein. In certain embodiments, an organosilicone composition comprising the Compound | it is used in the methods and compositions provided in this document. In certain embodiments, an organosilicone composition comprising the Compound | is used in the methods and compositions provided in this document. In certain embodiments of the methods and compositions provided herein, a composition comprising a polynucleotide molecule and one or more organosilicon compounds effective in the range of about 0.015 to about 2 weight percent (% by weight) (e.g. ., about 0, 01, 0, 015, O, 02, O, 025, O, 03, O, 035, O, 04, O, 045, O, 05, O, 055, O, O6, O, 065, O, 07, O, 075, O, 08, 0, 085, O, O9, O, 095, O, 1, 0, 2, O, 3, 0, 4, 0, 5, 0, 6, 0.7, 0.8, 0.9, 1,0,1,1,1,2, 1,3, 1,4,1,5,1,6,1,7,1,8,1, 9,2,0,2,1,2,2,2,3,2,5% in weight) is used or provided.
[053] [053] Compositions include, but are not limited to, components that are one or more polynucleotides essentially identical to, or essentially complementary to, a DHPS gene sequence (promoter, intron, exon, 5 'untranslated region, 3' untranslated region), a transfer agent that provides the polynucleotide to enter the plant cell, a herbicide that complements the action of the polynucleotide, one or more additional herbicides that further enhance the herbicide activity of the composition or provide an additional mode of action different from complementing herbicide, various salts and stabilizing agents that increase the usefulness of the composition as an admixture of the components of the composition.
[054] [054] The methods include one or more applications of a polynucleotide composition and one or more applications of a permeability-enhancing agent for conditioning a plant to polynucleotide permeation. When the conditioning agent
[055] [055] Compositions and methods are useful for modulating the expression of an endogenous DHPS gene or transgenic DHPS gene (for example, Pub. US Patent 6, 121, 513) in a plant cell. In several embodiments, a DHPS gene includes coding sequence (protein coding or translatable), non-coding sequence (non-translatable) or both coding and non-coding sequence. Compositions can include polynucleotides and oligonucleotides designed to target multiple genes or multiple segments of one or more genes. The target gene can include multiple consecutive segments of a target gene, multiple non-consecutive segments of a target gene, multiple alleles of a target gene, or multiple target genes of one or more species.
[056] [056] One aspect provides a method for modulating the expression of a DHPS gene in a plant including (a) conditioning a plant to permeation by polynucleotides and (b) treating the plant with polynucleotide molecules, in which the molecules polynucleotides include at least one segment of 18 or more contiguous nucleotides cloned from or otherwise identified from the target DHPS gene or in antisense or sense orientation, whereby the polynucleotide molecules permeate the interior of the plant and they induce modulation of the target gene. The conditioning and application of polynucleotides can be performed separately or in a single step. When conditioning and polynucleotide application are performed in separate steps, conditioning can precede or follow polynucleotide application within minutes, hours or days. In some modalities, more than one conditioning step or more than one application of a polynucleotide molecule can be performed on the same plant. In method modalities, the segment can be cloned or identified from (a) coding (protein coding), (b) non-coding (promoter and other molecules related to genes), or (c) both coding and non-coding parts of the target gene. Non-coding parts include DNA, such as promoter regions or RNA transcribed by DNA that provide RNA regulatory molecules, including but not limited to: introns, 5 'or 3' untranslated regions and microRNAs (mIiRNA), trans siRNAs action, natural antisense siRNAs and other small RNAs with regulatory function or RNAs having structural or enzymatic function including but not limited to: ribozymes, ribosomal RNAs, t-RNAs, aptamers and ribocomuters.
[057] [057] All publications, patents and patent applications are incorporated into this document by reference to the same extent as if each individual publication or patent application was specified specifically and individually to be incorporated by reference.
[058] [058] The following examples are included to demonstrate examples of certain preferred modalities. It should be understood by those skilled in the art that the techniques disclosed in the examples that follow represent approaches that the inventors have found to work well in practice and, therefore, can be considered to be examples of preferential ways for their practice. However, those versed in the technique must, in the light of the present disclosure, appreciate that many changes can be made in the modalities.
[059] [059] The target DHPS polynucleotide molecule occurs naturally in the genome of plants that include but are not limited to Amaranthus palmeri, Amaranthus rudis, Amaranthus hybridus, Amaranthus lividus, Amaranthus viridis, Ambrosia trifida, Conyza canden- sis, Digitaria sanguinalis, Euphorbia heterophylla, Kochia scoparia, Lilium multiflorum, and include molecules related to the expression of a polypeptide identified as a DHPS, which includes genomic DNA (gDNA) and coding cDNAs comprising coding and non-coding regions of a DHPS gene and fragments of them, as shown in table 1.
[060] [060] Polynucleotide molecules were extracted from these plant species by standard methods in the field, for example, total RNA was extracted using the Trizol reagent (Invitrogen Corp, Carlsbad, CA. Cat. No. 15596-018), following the protocol from the manufacturer or respective modifications by those skilled in the polynucleotide extraction technique that can improve the recovery or purity of the extracted RNA. Briefly, start with 1 gram of crushed plant tissue for extraction. Pre-aliquot 10 milliliters (mL) reagent Trizol for conical tubes of 15 mL, add the ground powder to tubes and shake to homogenize. Incubate the homogenized samples for 5 minutes (min) at room temperature (RT) and then add 3 ml of chloroform. Shake the tubes vigorously by hand for 15-30 seconds (sec) and incubate at RT for 3 min. Centrifuge the tubes at 7,000 revolutions per minute (rpm) for 10 minutes at 4 degrees C. Transfer the aqueous phase to a new 1.5 mL tube and add 1 volume of isopropyl-
[061] [061] DNA was extracted using EZNA SP plant DNA Mini kit (Omega Biotek, Norcross, GA, Cat% & D5511) and Lysing Matrix E tubes (Q-Biogen, Cattt6914), following the manufacturer's protocol or respective modifications by those versed in the technique of polynucleotide extraction that can improve the recovery or purity of the extracted DNA. Briefly, aliquot floor tissue to a Lise E matrix tube on dry ice, add 800ul SP1 of Buffer for each sample, homogenize in a granule beater for 35-45sec, incubate on ice for 45-60 sec , centrifuge at 214000 rpm for 1 min in RT, add 10 microliters RNase A to the lysate, incubate at 65'C for 10 min, centrifuge for 1 min in RT, add 280ul Buffer SP2 and vortex to mix, incubate samples on ice by 5min, centrifuge> 10, 000g for 10 min at RT, transfer the supernatant to a homogenizer column in a 2ml collection tube, centrifuge 10, 000 g for 2 min at RT, transfer the cleared lysate into a micro-centrifuge tube of 1.5 ml, add 1.5 volumes Buffer SP3 to the clean lysate, vortex immediately to obtain a homogeneous mixture, transfer up to 650ul supernatant to the Hi-Bind column, centrifuge 10,000 g for 1 min, repeat, apply 100 ul 65'C elution buffer to the column, centrifugation at 10,000 g for 5 min at RT
[062] [062] State-of-the-art DNA sequencers, such as 454-FLX (Roche, Branford, CT) and SOLID (Applied Biosystems), and the Genome Analyzer genome analyzer (HiSeg2000, Illumina, San Diego, CA) to provide the polynucleotide sequence of DNA and RNA extracted from plant tissues. Raw sequence data was assembled into contigs. The contig sequence was used to identify trigger molecules that can be applied to a plant to allow regulation of gene expression.
[063] [063] The target DNA sequence isolated from the genomic (gD-NA) and coding (cCDNA) DNA from various weed plant species for the DHPS gene and the assembled contigs as shown in SEQ ID NOs 1-54 and table | (see supplementary annex 40 21 (58641) Btable1.doxc) Example 2. Polynucleotides related to the triggering molecules
[064] [064] The gene sequences and fragments in Table 1 were divided into 200 polynucleotide lengths (200-mer) with 25 overlapping polynucleotide regions and are shown in Table 2, SEQ ID NO: 55-906. These polynucleotides are tested to select the most effective triggering regions across the length of any target sequence. The triggering polynucleotides are constructed as ssDNA or ssRNA, dsRNA, or dsDNA or hybrids of sense or antisense dsDNA / RNA and combined with an organosilicone-based transfer agent to provide a polynucleotide preparation. Polynucleotides are combined in sets of two to three polynucleotides per set, using 4-8 nmol of each polynucleotide. Each set of polynucleotides is prepared with the transfer agent and applied to a plant or field of plants in combination with a herbicide containing DHPS inhibitor or followed by a DHPS inhibitor treatment one to three days after application. polynucleotide, to determine the effect on the plant's susceptibility to a DHPS inhibitor. The effect is less
[065] [065] The target DNA sequence isolated from the genomic (gD-NA) and coding (cCDNA) DNA from various weed plant species for the DHPS gene and the assembled contigs as shown in SEQ ID NOs 1-54 were divided in polynucleotide fragments as shown in Table 2 (see supplementary annex 40 21 (58641) Btable2.doxc) as shown in SEQ ID NOs 55-906.
[066] [066] The gene sequences and fragments in Table 1 were compared and 21-mers of contiguous polynucleotides were identified that had homology across multiple DHPS gene sequences. The purpose is to identify triggering molecules that are useful as herbicidal molecules or in combination with a DHPS-inhibiting herbicide over a wide range of weed species. The sequences shown in Table 3 represent 21-mers that were present in the DHPS gene of at least eight of the weed species in Table 1. It is contemplated that additional 21-mers can be selected from sequences in Table 1 that are specific to a single weed species or some weed species within a genus or trigger molecules that have at least 18 contiguous nucleotides, at least 19 contiguous nucleotides, at least 20 contiguous nucleotides or at least 21 nucleotides contiguous in length and at least 85 percent identical to a DHPS gene sequence selected from the group consisting of SEQ ID NO: 1-54 or fragment thereof.
[067] [067] Through this method it is possible to identify an oligonucleotide or several oligonucleotides that are the most effective triggering molecule for effecting plant sensitivity to a DHPS inhibitor or modulating the expression of a DHPS gene. The modulation of the expression of the DHPS gene is determined by detecting the DHPS SiRNA molecules specific to a DHPS gene or by observing a reduction in the amount of DHPS RNA transcript produced in relation to an untreated plant. SiRNA detection can be carried out, for example, using kits such as mirVana (Ambion, Australia TX) and mirPremier (Sigma-Aldrich, St. Louis, MO).
[068] [068] The target DNA sequence isolated from the genomic (gD-NA) and coding (cCDNA) DNA from various weed plant species for the DHPS gene and the assembled contigs as shown in SEQ ID NOs 1-54 were divided in fragments as shown in Table 3 (see supplementary annex 40 21 (58641) Btable3.doxc) as shown in SEQ ID NOs 907-1175.
[069] [069] Palmer amaranth plants sensitive to glyphosate (A. palmeri R-22) were grown in a greenhouse (30/20 C day / night T; 14 hours photoperiod) in 4-inch square pots containing Sun Gro & Redi -Earth and 3.5 kg / cubic meter of Osmocote & 14-14-14 fertilizer. Palmer amaranth plants at 5 to 10 cm height were pretreated with a mixture of short dsDNA-triggering oligonucleotides (25mer) targeting DHPS coding and non-coding regions using 4 nmol of each oligonucleotide and submitting pool 5-6 oligonucleotides in each treatment, formulated in 20 millimolar sodium phosphate buffer (pH 6, 8) containing 2% ammonium sulfate and 1% Silwet L-77. The plants were treated manually by pipetting 10 µl of polynucleotide solution into four fully expanded mature leaves, for a total of 40 microliters of solution per plant. There were eight treatment pools, DHPS1-6, DHPS7-12, DHPS13-18, DHPS19-24, DHPS25-30, 36- DHPS31-36, DHPS37-42 and DHPS43-47 (table 4). Twenty-four hours later, the plants were treated with pendimethalin (Prowl &, BASF, this herbicide works as a mitosis inhibitor similar to asulam as a known DHPS inhibitor, other di-nitroaniline herbicides that work to inhibit mitosis include but are not limited to Sonalan & (etalfluralin), Squadron1O, Steel1 O, Treflan O / Trilin O / Tri-4) at a rate of 12l / b / ac. Four replications of each treatment were conducted. Plant height was determined just before polynucleotide treatment and at intervals of up to fourteen days after herbicide treatments to determine the effect of the oligonucleotide and herbicide treatments. The results were expressed as a percentage reduction in height in relation to the untreated control (no formulation and no trigger molecules), another treatment was the formulation control, which is the herbicide plus buffer plus ammonium plus Silwet. Figure 1 illustrates the results of this test. Three of the pooled oligonucleotides showed an increase in herbicidal activity, these are DHPS1-6, DHPS7-12 and DHPS13-18. Further tests of the unique oligonucleotides of DHPS1-6 and DHPS7-12 demonstrated that DHPS1 (SEQ ID NO: 1176) and DHPS11 (SEQ ID NO: 1186) had the highest activity among the oligonucleotides in those respective pools with these 2 oligonucleotides providing more than 5% increase in herbicide lesions.
[070] [070] Table 4. DHPS dsDNA oligonucleotides. SEQ Name j [sense sequence antisense sequence triggering | ID NO: deador DHPST ITTTTATTCTAMAGTTGCHeGGAGG f1176 | ICOTCCGAAGCAACTTTAGAATAAAA DHPS2 1177 CCGTCAAGAAGGGGGCACACATTGT | JACAATGTGTGCCCCCTTCTTGACGG pHPS3 NM178 IGAATGATGTCTCIaGTGGgAAACTO IGAGTTTCCCACTAGAGACATCATTC DHPS4 1179 | GATTCCGAGATGTTTAATGTTGTTG - | CAACAACATTAMACATCTCGGAATC PpHPSS 1180 | CGGACCTTAMAGTTCCTTATATAGC IGCTATATAAGGAACTTTAAGGTCCG DHPS6 [1181 JAATGCACATGCGAGGAGATCCGACT [AGTCGGATCTCCTCGCATGTGCATT DHPS7 [ 1182 ITCAATGCAAMAACTCTGAGAACTTGA [TCAAGTTCTCAGAGTTTTGCATTGA DHPS8 [1183 | CCTACAATGATGTTTGTAAGCAAGT [ACTTGCTTACAMACATCATTGTAGG prPs9 1184 IGGCTTCGGAGTTGAGTTCTAGGGTc | GACCCTAGAACTCAACTCCGAAGCC DHPSTO [1785 | ATAGATGCAGAATTATCGGGAATTC - [GAATTCCCGATAATTCTGCATCTAT DHPST11 [1786 | CTGCTTGGAGGATAGTTATTGATCC - JGGATCAATAACTATCCTCCAAGCAG DHPS13 [1788 | AATCAAMAATTTGGAAATTCITAGTG JCACTAAGAATTTCCAAATTTTGATT PHPS14 1189 ISTTTACAMAAGATACGGGAAGAGAT ATCTCTTCCCGTATCTTTTGTAAAC
[071] [071] A method for controlling weeds in a field comprises the use of triggering polynucleotides that can modulate the expression of a DHPS gene in one or more species of target weed plants. In Table 3, an analysis of DHPS gene sequences from multiple plant species provided a collection of 21-mer polynucleotides that was common to at least 4 species and can be used in compositions to affect growth or development or sensitivity to the DHPS-inhibiting herbicide to control multiple weed species in a field.
[072] [072] The method includes creating a composition comprising components that include at least one polynucleotide from Table 3 (SEQ ID NO: 907-1175) or any other expression of effective gene modulating essentially identical or specific polynucleotides essentially complementary to SEQ ID NO: 1-54 or a fragment thereof, a transfer agent that mobilizes the polynucleotide in a plant cell and a DHPS inhibiting herbicide and optionally a polynucleotide that modulates the expression of a specific gene essential and optionally a co-herbicide that has a different mode of action compared to a DHPS inhibitor. The polynucleotide of the composition includes a dsRNA, ssDNA or dsDNA or a combination thereof. A composition containing a polynucleotide may have an utilization rate of about 1 to 30 grams or more per acre, depending on the size of the polynucleotide and the number of polynucleotides in the composition. The composition can include one or more additional co-herbicides as needed to provide effective multi-species weed control. Crop safety can be enhanced by reducing the amount of effective herbicide needed to control weeds in the field. A field of cultivated plants or an environment of turf grass in need of weed control is treated by spray application of the compost.
[073] [073] A method of controlling weeds and plant pests and pathogens in a field of crop plants tolerant to the DHPS inhibitor is provided, wherein the method comprises applying a composition comprising a DHPS triggering oligonucleotide, a inhibitor composition of DHPS and an admixture of a pest control agent. For example, admixture comprises insecticides, fungicides, nematocides, bactericides, acaricides, growth regulators, chemosterilizers, semiochemicals, repellents, attractants, pheromones, food stimulants or other biologically active compounds or biological agents, such as , microorganisms.
[074] [074] For example, admixture comprises a fungicidal compound for use in a DHPS inhibitor tolerant crop plant to prevent or control plant disease caused by a fungal plant pathogen, the admixture fungicidal compound may be a systemic or contact fungicide or mixtures of each. More particularly, the fungicidal compound includes, but is not limited to, members of the chemical groups strobilurins, triazoles, chloronitriles, carboxamides and their mixtures. The composition may additionally have an admixture that comprises an insecticidal compound or agent.
[075] [075] The DHPS-triggering oligonucleotide tank and DHPS-inhibitor or mitosis-inhibiting herbicide (eg swelling or other dinitroaniline herbicides) mix with fungicides, insecticides or both are tested for use in soy and corn for control of pests and leaf diseases. Testing is carried out to develop a method for using mixtures of triggering oligonucleotides and formulating asulam and various commercially available fungicides for weed and pest control. Field plots are planted with soy or corn. All plots receive a posterior plant application of the DHPS + trigger asulating about 3 weeks after planting. Mixtures of trigger-killer + asulam or trigger + asulam + fungicide + insecticides are used to treat plots in the R1 phase of soy development (first flowering) or corn tassel phase. Data is taken for weed control percentage in 7 to 21 days after R1 treatment, soy safety (% necrosis, chlorosis, growth rate): 5 days after treatment, disease classification, classification pest and yield adjustments (bushels / Acre). These mixtures and treatments are designed to provide simultaneous weeds and pest control, such as fungi pest control, for example, leaf rust disease; and control of insect pests, for example, aphids, caterpillars, loopers, beetles, bedbugs and leaf funnels.
[076] [076] Agricultural chemicals are provided in containers suitable for safe storage, transportation and distribution, stability of chemical compositions, mixing with solvents and instructions for use. A container of a mixture of a triggering oligonucleotide + herbicide + fungicidal compound, or a mixture of the triggering oligonucleotide + herbicidal compound and an insecticidal compound, or a triggering oligonucleotide + a herbicidal compound and a fungicidal compound and an insecticidal compound (for example) , lambda-cyhalothrin, Warrier O). The container can additionally provide instructions on the effective use of the mixture. Containers of the present invention can be of any material that is suitable for storing the chemical mixture. Containers of the present invention can be of any material that is suitable for loading the chemical mixture. The material can be cardboard, plastic, metal or a composition of these materials. The container can have a volume of 0, 5 liters, 1 liter, 2 liters, 3-5 liters, 5-10 liters, 10 to 20 liters, 20-50 liters or more depending on the need. A tank mix of the triggering oligonucleotide + herbicidal compound and a fungicidal compound is provided, application methods for cultivation, to obtain an effective dose of each compound are known to those skilled in the art and can be refined and further developed. - developed depending on the cultivation, weather conditions and application equipment used.
[077] [077] Insecticides, fungicides, nematocides, bactericides, strokes, growth regulators, chemosterilizers, semi-chemicals, repellents, attractions, pheromones, food stimulants or other biologically active compounds can be added to the triggering oligonucleotide multi-component pesticide giving an even broader spectrum of agricultural protection. Examples of such agricultural protectors with which compounds of this invention can be formulated: insecticides such as abamectin, acephate, azinphos-methyl, bifentrin, buprofezin, carbofuran, chlorfenapyr, chlorpyrifos, chlorpyrifos-methyl, ciflutrin, beta-ciflutrin, cihalothrin, lambda-ci , deltametrin, diafentiuron, diazinon, diflubenzuron, dimetoate, esfenvalerate, fenoxicarb, fenpropatrin, fenvalerate, fipronil, flucitrinate, tau-fluvalinate, fonofos, imidacloprid, isofenphos, methoxy, methidyl, methoxy, methoxy, methoxy, methoxy, methoxy, methoxy, methoxy, methoxy, methoxy, methoxy, methoxy, methoxy, methoxy, methoxy, methoxy, methoxy
[078] [078] Table 1 SEQ SPECIES TYPE LONG | SEQ
[079] [079] Table 2 SEQ Species Name Type Home | Final Seq EF Er FFF 55 Amaranthus | DHP At 1 | cDONAContig 1 200 AGATTTGTGAGCGCCCT hybridus GTAGCAGCTGATAGGG ATCCTGCTACCGTTGCT TCAATAACTGCTGGAGT TTTAGGTGGTGCAAACA TTGTAAGAGTACATAAT GTGAGGGATAACCTTGA TGCTGTCAAGTTATGTG ATGCCATACTCGGAAAA ACTGATTAACTGCTTATT TGTACCACCTTGTGA-
[080] [080] Table 3 SEQ Seq Gene | HSpecies Species EL FS pp 907 TTATGTACTCTTACAATGTTT DHP 5 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis, Kochia sco- paria 908 TGTACTCTTACAATGTTTGCA DHP 5 Amaranthis- AGA, Amathth- DHP 5 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis, Kochia sco- paria 910 TGAAAGGATATGGGAAAGACC DHP 5 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis, Amaranthus viridis, ETCT- - thus palmeri, Amaranthus rudis, Amaranthus viridis, Kochia sco- paria 912 TCTTACAATGTTTGCACCACC DHP 5 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis, Kochia sco-paria 913 TATGTATTTTGGTATTTTG , Amaranthus viridis, Kochia sco-paria thus palmeri, Amaranthus rudis, Amaranthus viridis, Kochia sco - paria
915 GTGGTGCAAACATTGTAAGAG DHP 5 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis, Kochia scoparia
916 GTGCAAACATTGTAAGAGTAC DHP 5 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis, Kochia scoparia
917 GTCTTTCCCATATCCTITTCAT DHP 5 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis, Kochia scoparia
918 GCAAACATTGTAAGAGTACAT DHP 5 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis, Kochia scoparia
919 CATTGTAAGAGTACATAATGT DHP 5 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis, Kochia sco-paria
920 CATTATGTACTCTTACAATGT DHP 5 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis, Kochia scoparia
921 ATTATGTACTCTTACAATGTT DHP 5 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis, Kochia scoparia
922 TTTTCTACATCAGACCCAATA DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
923 TTTTCATTCCATCCTTCCCGA DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
924 TTTTCAATCTGTCGATACTGC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
925 TTTTATGAGACCAATCCCATA DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
926 TTTTAGGTGGTGCAAACATTG DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
927 TTTGCACCACCTAAAACTCCA DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
928 TTTCTACATCAGACCCAATAC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
929 TTTCCCATATCCTTTCATGGG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
930 TTTCATTCCATCCTTCCCGAT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
931 TTTCAATCTGTCGATACTGCG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
932 TTTATGAGACCAATCCCATAA DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
933 TTTAGGTGGTGCAAACATTGT DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
934 TTTAGGGTGAGCTCTGAGAGC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
935 TTGTATTGGGTCTGATGTAGA DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
936 TTGTAAGAGTACATAATGTGA DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
937 TTGGTCTCATAAAACCTCTGT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
938 TTGGGTCTGATGTAGAAAATG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
939 TTGGCCTAGGACCATACCTTA DHP Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis thus palmeri, Amaranthus rudis,
The area re = en = O
941 TTGCTAAGGTTCGTCAGATGA DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
942 TTGCACCACCTAAAACTCCAG DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
943 TTGATTGTATTGGGTCTGATG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
944 TTGACTTGGACATACTATTIT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
945 TTGACTCCTGATAGCTTTAGT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
946 TTGAACTTGACTCCTGATAGC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
947 TTCTACATCAGACCCAATACA DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
948 TTCCGCCATCACTAAAGCTAT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
949 TTCCCTAATCGGGAAGGATGG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
and resmaeehae n EE
950 TTCCCGATTAGGGAACTTCCA DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
951 TTCCCATATCCTTTCATGGGG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
952 TTCCCATAAAATAGTATGTCC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
953 TTCCATCCTTCCCGATTAGGG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
954 TTCATTCCATCCTTCCCGATT DHP 4 Amaranthus lividus, Amaranth
ps THESIS
E ss ss 955 TTCAATCTGTCGATACTGCGG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis 956 TTCAAGACTCCCATTACAGAG DHP 4 Amaranthus lividus, Amaran- thus rudis, Amaranthus víridis, KATHATHAGAHAGAHATHATHMATICHHATHATHATHATHATHATHATHATHATHATHATHATHATHATHATHATHHHHHHH rudis, Amaranthus viridis 958 TTATCCCTCACATTATGTACT DHP 4 Amaranthus hybridus, Amaranthus palmeri, Amaranthus rudis, Amaranthus viridis Amaranthus 4 959 TTATATAGCAATGCACATGCG DHP palmeri, Amaranthus rudis, Amaranthus viridis, Kochia scoparia TTAGGTGGTGCAAACATTGTA DHP 4 Amaranthus hybridus, Amaranthus palmeri, Amaranthus rudis, Amaranthus viridis 961 TTAGGGTGAGCTCTGAGAGCC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis 962 TTAGGGAACTTCCACCGAGTT DHP 4 Amaranthus lividus, Amaran-ththACHGANAGAHATHAT, Amaranth thus Amaranthus rudis, Amaranthus viridis 96 4 TTACAATGTTTGCACCACCTA DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis 965 TGTTTGGACACCACCTAAAACTC DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, AmaranthGRISGIS, AmaranthGATHISGATHRATISMATHTHATISMATHRATISG 967 TGTCCAAGTCAATTGGCCTAG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis 968 TGTCATTTTCTACATCAGACC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
TGTAGAAAATGACACTATTTG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
Amaranthus viridis 970 TGTAAGAGTACATAATGTGAG DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis,
Amaranthus viridis 971 TGGTGCCATCACAAATGGTCT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
Amaranthus viridis 972 TGGTCTTTCCCATATCCTITTC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
Amaranthus viridis 973 TGGTCCTAGGCCAATTGACTT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
Amaranthus viridis 974 TGGGTCTGATGTAGAAAATGA DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
Amaranthus viridis 975 TGGGATTGGTCTCATAAAACC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
Amaranthus viridis 976 TGGGAGTCTTGAACTTGACTC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
Amaranthus viridis 977 TGGGAAAGACCATTTGTGATG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
Amaranthus viridis 978 TGGCCTAGGACCATACCTTAT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
Amaranthus viridis 979 TGGACATACTATTTTATGGGA DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
Amaranthus viridis 980 TGGAATGAAAAGGGTTTTGCC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
Amaranthus viridis TGCTGGAGTTTTAGGTGGTGC DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis,
Amaranthus viridis 982 TGCTAAGGTTCGTCAGATGAT DHP Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
Amaranthus viridis thus palmeri, Amaranthus rudis, Romeo re = en = O 984 TGCCATCACAAATGGTCTTTC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
Amaranthus viridis 985 TGCACCACCTAAAACTCCAGC DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis,
Amaranthus viridis 986 TGATTGTATTGGGTCTGATGT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
Amaranthus viridis 987 TGATGTAGAAAATGACACTAT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
Amaranthus viridis 988 TGATAGCTTTAGTGATGGCGG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
Amaranthus viridis 989 TGAGGCTCTCAGAGCTCACCC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
Amaranthus viridis TGAGCTCTGAGAGCCTCACTA DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
Amaranthus viridis 991 TGACTTGGACATACTATTTTA DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
Amaranthus viridis 992 TGACTCCTGATAGCTTTAGTG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, and reams 993 TGAACTTGACTCCTGATAGCT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
Amaranthus viridis 994 TGAAAAGGGTTTTGCCCGTTG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
Amaranthus viridis 995 TCTTGAACTTGACTCCTGATA DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
Amaranthus viridis TCTGTCGATACTGCGGTTGCT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
Amaranthus viridis 997 TCTGATGTAGAAAATGACACT DHP 4 Amaranthus lividus, Amaranrp PEIES]
E and FS 998 TCTGACGAACCTTAGCAACCG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis TCGGTGGAAGTTCCCTAATCG DHP 4 Amaranthus lividus, Amaran- thus palmeri, AmaranthUS rudis, AmaranthGATisRHisis, AmaranthGATis- AmaranthGATIS, AmaranthGATIS , Kochia scoparia 1001 TCGATACTGCGGTTGCTAAGG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis 1002 TCCTTCCCGATTAGGGAACTT DHP 4 Amaranthus lividus, Amaran- thus palmeri, AmaththusGranThatGamTag, AmaththisGamtat, Amaranthus Amaranthus viridis 1004 TCCTAGGCCAATTGACTTGGA DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis 1005 TCCGCCATCACTAAAGCTATC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rTC, Amaranthus r6, Amaranthus r6 , Amaranthus viridis 1007 TCCCTAA TCGGGAAGGATGGA DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis 1008 TCCCGATTAGGGAACTTCCAC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis, Amaranthus virCCis 100AT TCATTTATT 1010 TCAGGAGTCAAGTTCAAGACT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis 1011 TCACTAAAGCTATCAGGAGTC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1012 TCACAAATGGTCTTTCCCATA DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1013 TCAATTGGCCTAGGACCATAC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1014 TCAATCTGTCGATACTGCGGT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1015 TCAAGTTATGTGATGCCATAC DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1016 TCAAGGTTATCCCTCACATTA DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1017 TCAAGACTCCCATTACAGAGG DHP 4 Amaranthus lividus, Amaran- thus rudis, Amaranthus viridis, Kochia scoparia
1018 TATGTCCAAGTCAATTGGCCT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1019 TATGGTCCTAGGCCAATTGAC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1020 TATGGCATCACATAACTTGAC DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1021 TATGAGACCAATCCCATAAGC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1022 TATCGACAGATTGAAAACTTC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1023 TATCCCTCACATTATGTACTC DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1024 TATAGCAATGCACATGCGAGG DHP 4 Amaranthus palmeri, Amaran- thus rudis, Amaranthus víridis, Kochia scoparia
1025 TAGTGTCATTTTCTACATCAG DHP Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis thus palmeri, Amaranthus rudis,
seem to pray O
1027 TAGGGTGAGCTCTGAGAGCCT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1028 TAGGGAACTTCCACCGAGTTT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1029 TAGGCCAATTGACTTGGACAT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1030 TAGGACCATACCTTATTCCCT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1031 TAGCTTTAGTGATGGCGGAAG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1032 TAGCAACCGCAGTATCGACAG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1033 TAGAAAATGACACTATTTGTA DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1034 TACTGCGGTTGCTAAGGTTCG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1035 TACATCAGACCCAATACAATC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
and omnes
1036 TACATAATGTGAGGGATAACC DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1037 TAAGGTTCGTCAGATGATCTC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1038 TAAGAGTACATAATGTGAGGG DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1039 TAAAGCTATCAGGAGTCAAGT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1040 TAAACTCGGTGGAAGTTCCCT DHP 4 Amaranthus lividus, Amaranth-
Fpp EE ED] And FS
1041 GTTTTCAATCTGTCGATACTG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1042 GTTTTATGAGACCAATCCCAT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1043 GTTTTAGGTGGTGCAAACATT DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1044 GTTTGCACCACCTAAAACTCC DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1045 GTTGCTAAGGTTCGTCAGATG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
1046 GTTCCCTAATCGGGAAGGATG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1047 GTTATCCCTCACATTATGTAC DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1048 GTGTCATTTTCTACATCAGAC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1049 GTGGAATCTTTGAAGCATGGG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1050 GTGCCATCACAAATGGTCTTT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1051 GTGAGGCTCTCAGAGCTCACC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1052 GTGAGCTCTGAGAGCCTCACT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1053 GTCTTGAACTTGACTCCTGAT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1054 GTCGATACTGCGGTTGCTAAG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1055 GTCCTAGGCCAATTGACTTGG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1056 GTCCAAGTCAATTGGCCTAGG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1057 GTCATTTTCTACATCAGACCC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1058 GTATGTCCAAGTCAATTGGCC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1059 GTATCGACAGATTGAAAACTT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1060 GTAGAAAATGACACTATTIGT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1061 GTACAAATAGTGTCATITTTCT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1062 GTAAGAGTACATAATGTGAGG DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1063 GGTTGCTAAGGTTCGTCAGAT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1064 GGTGGAATCTTTGAAGCATGG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1065 GGTGGAAGTTCCCTAATCGGG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1066 GGTGCCATCACAAATGGTCTT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1067 GGTCCTAGGCCAATTGACTTG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1068 GGTATGGTCCTAGGCCAATTG DHP Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis thus palmeri, Amaranthus rudis,
love you and O
1070 GGGCAAAACCCTTTTCATTCC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1071 GGGATTGGTCTCATAAMACCT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1072 GGGAGTCTTGAACTTGACTCC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1073 GGGAATAAGGTATGGTCCTAG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1074 GGGAAGGATGGAATGAAAAGG | DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1075 GGGAAAGACCATTTGTGATGG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1076 GGCCTAGGACCATACCTTATT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1077 GGATTGGTCTCATAAAACCTC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1078 GGATGGAATGAAAAGGGTTTT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
05 crase e) EEE
1079 GGATATGGGAAAGACCATTTG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1080 GGAGTCTTGAACTTGACTCCT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1081 GGAATAAGGTATGGTCCTAGG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1082 GGAAGTTTTCAATCTGTCGAT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1083 GGAAGTTCCCTAATCGGGAAG DHP 4 Amaranthus lividus, Amaran-
pp EEE TETE]
el | Female 1084 GGAAGGATGGAATGAAAAGGG | DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1085 GGAAAGACCATTTGTGATGGC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1086 GCTAAGGTTCGTCAGATGATC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1087 GCGGTTGCTAAGGTTCGTCAG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1088 GCCTAGGACCATACCTTATTC DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
1089 GCCATCACTAAAGCTATCAGG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1090 GCCAATTGACTTGGACATACT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1091 GCATGTGCATTGCTATATAAG DHP 4 Amaranthus palmeri, Amaran- thus rudis, Amaranthus viridis, Kochia scoparia
1092 GCAACCGCAGTATCGACAGAT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1093 GCAAAACCCTTTTCATTCCAT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1094 GATTGGTCTCATAAAACCTCT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1095 GATTAGGGAACTTCCACCGAG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1096 GATGTAGAAAATGACACTATT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1097 GATGGAATGAAAAGGGTTTTG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1098 GATATGGGAAAGACCATTTGT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1099 GATACTGCGGTTGCTAAGGTT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1100 GAGTCTTGAACTTGACTCCTG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1101 GAGTATGGCATCACATAACTT DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1102 GAGGCTCTCAGAGCTCACCCT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1103 GAGCTCTGAGAGCCTCACTAT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1104 GACTTGGACATACTATTITAT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1105 GACTCCCATTACAGAGGTTTT DHP 4 Amaranthus lividus, Amaran- thus rudis, Amaranthus viridis, Kochia scoparia
1106 GACGAACCTTAGCAACCGCAG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1107 GACCATTTGTGATGGCACCAT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1108 GAATGAAAAGGGTTTTGCCCG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1109 GAAGTTCCCTAATCGGGAAGG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1110 GAAGGATGGAATGAAAAGGGT | DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1111 GAACTTGACTCCTGATAGCTT DHP Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis thus palmeri, Amaranthus rudis,
the same pray O
1113 GAAAAGGGTTTTGCCCGTTEG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1114 CTTTTCATTCCATCCTTCCCG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1115 CTTTCCCATATCCTTTCATGG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1116 CTTGGACATACTATTITTATGG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1117 CTTGACTCCTGATAGCTTTAG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1118 CTTGAACTTGACTCCTGATAG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1119 CTTACAATGTTTGCACCACCT DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1120 CTGCTGGAGTTTTAGGTGGTG DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1121 CTGATAGCTTTAGTGATGGCG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
NaN
1122 CTCGCATGTGCATTGCTATAT DHP 4 Amaranthus palmeri, Amaran- thus rudis, Amaranthus viridis, Kochia scoparia
1123 CTCCTGATAGCTTTAGTGATG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1124 CTACATCAGACCCAATACAAT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1125 CTAATCGGGAAGGATGGAATG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1126 CTAAGGTTCGTCAGATGATCT DHP 4 Amaranthus lividus, Amaranthus
pp EEE]
Ce | Phase 1127 CGGTGGAAGTTCCCTAATCGG DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1128 CGCTTATGGGATTGGTCTCAT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1129 CGATACTGCGGTTGCTAAGGT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1130 CCTTATATAGCAATGCACATG DHP 4 Amaranthus palmeri, Amaran- thus rudis, Amaranthus viridis, Kochia scoparia
1131 CCTAATCGGGAAGGATGGAAT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
1132 CATCAAGGTTATCCCTCACAT DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1133 CATAATGTGAGGGATAACCTT DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1134 CATAAAATAGTATGTCCAAGT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1135 CAGAGGTTTTATGAGACCAAT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1136 CACATTATGTACTCTTACAAT DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1137 CACAAATGGTCTTTCCCATAT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1138 CAATTGACTTGGACATACTAT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1139 CAATCTGTCGATACTGCGGTT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1140 CAAGTTATGTGATGCCATACT DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1141 CAAGGTTATCCCTCACATTAT DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1142 CAAGACTCCCATTACAGAGGT DHP 4 Amaranthus lividus, Amaran- thus rudis, Amaranthus viridis, Kochia scoparia
1143 CAACCGCAGTATCGACAGATT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1144 ATTTTCTACATCAGACCCAAT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1145 ATTGGCCTAGGACCATACCTT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1146 ATTGATTGTATTGGGTCTGAT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1147 ATTGACTTGGACATACTATTT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1148 ATTAGGGAACTTCCACCGAGT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1149 ATGTTTGCACCACCTAAAACT DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1150 ATGTAGAAAATGACACTATTT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1151 ATGGTCTTTCCCATATCCTITT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1152 ATGGTCCTAGGCCAATTGACT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1153 ATGGGAGTCTTGAACTTGACT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1154 ATGGGAAAGACCATTTGTGAT DHP Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis thus palmeri, Amaranthus rudis, rm o re = nen = O
1156 ATCCTTCCCGATTAGGGAACT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1157 ATCCCTCACATTATGTACTCT DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1158 ATCACTAAAGCTATCAGGAGT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1159 ATCAAGGTTATCCCTCACATT DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1160 AGTTTTCAATCTGTCGATACT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1161 AGGTTATCCCTCACATTATGT DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1162 AGGTATGGTCCTAGGCCAATT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1163 AGGATGGAATGAAAAGGGTTT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1164 AGGATATGGGAAAGACCATTT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis,
1165 AGGACCATACCTTATTCCCTT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1166 AGACTCCCATTACAGAGGTTT DHP 4 Amaranthus lividus, Amaran- thus rudis, Amaranthus viridis, Kochia scoparia
1167 ACTGCTGGAGTTTTAGGTGGT DHP 4 Amaranthus hybridus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1168 ACTGCGGTTGCTAAGGTTCGT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1169 ACGGGCAAAACCC CATT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1170 ACCATTTGTGATGGCACCATT DHP Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1171 AATTGACTTGGACATACTATT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1172 AATGGTCTTTCCCATATCCOTT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
1173 AAGGATGGAATGAAAAGGGTT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis
11174 AAGACTCCCATTACAGAGGTT DHP 4 Amaranthus lividus, Amaran- thus rudis, Amaranthus viridis, Kochia scoparia
1175 AACTTGACTCCTGATAGCTTT DHP 4 Amaranthus lividus, Amaran- thus palmeri, Amaranthus rudis, Amaranthus viridis

权利要求:
Claims (15)
[1]
1. Plant control method characterized by the fact that it comprises: treating a plant with a composition comprising a polynucleotide and a transfer agent, in which the said polynucleotide is essentially identical or essentially complementary to a sequence of the DHPS gene or fragment thereof, or to an RNA transcript of said DHPS gene sequence or fragment thereof, wherein said DHPS gene sequence is selected from the group consisting of SEQ ID No. 1-54 or a polynucleotide fragment thereof , where said plant growth or development or reproductive capacity is regulated, suppressed or delayed or said plant is more sensitive to a DHPS-inhibiting herbicide or mitosis-inhibiting herbicide as a result of said polynucleotide-containing composition in relation to an untreated plant with said composition.
[2]
2. Method according to claim 1, characterized by the fact that (i) said transfer agent comprises an organosilicone surfactant composition or compound contained therein, or (ii) said plant is selected from the group consisting of by Amaranthus palmeri, Amaranthus rudis, Amaranthus hybridus, Amaranthus lividus, Amaranthus viridis, Ambrosia trifida, Conyza candensisis, Digitaria sanguinalis, Euphorbia heterophylla, Kochia scoparia and Lolium multiflorum, or (ili) the composition further comprises DHPS-inhibiting or mitosis-inhibiting herbicide and external application to a plant with said composition, preferably said composition additionally comprises one or more co-herbicides other than said DHPS-inhibiting or mitosis-inhibiting herbicide; (iv) said polynucleotide fragment is 18 contiguous, 19 contiguous nucleotides, 20 contiguous nucleotides or at least 21 contiguous nucleotides in length and at least 85 percent identical to a DHPS gene sequence selected from the group consisting of SEQ ID No. : 1-54, preferably (a) said polynucleotide fragment is selected from the group consisting of sense or antisense sSDNA or ssRNA, dsR-NA, or dsDNA, or dsDNA / RNA hybrids, or (b) said composition it comprises any combination of two or more of said polynucleotide fragments and external application to a plant with said composition.
[3]
3. Composition characterized by the fact that it comprises a polynucleotide and a transfer agent, in which said polynucleotide is essentially identical or essentially complementary to a sequence of the DHPS gene, or to an RNA transcript of the said sequence of the DHPS gene, in which said sequence of the DHPS gene is selected from the group consisting of SEQ ID No.: 1-54 or a polynucleotide fragment from it and from where a plant treated with that composition has its growth or development capacity or regulated reproductive, suppressed or delayed or said plant is more sensitive to a DHPS-inhibiting herbicide or mitosis-inhibiting herbicide as a result of said polynucleotide-containing composition compared to an untreated plant with said composition.
[4]
4. Composition according to claim 3, characterized by the fact that (i) said transfer agent is an organosilicone composition, or (ii)
said polynucleotide fragment is 18 contiguous, 19 contiguous nucleotides, 20 contiguous nucleotides or at least 21 contiguous nucleotides in length and at least 85 percent identical to a sequence of the DHPS gene selected from the group consisting of SEQ ID no: 1- 54, or (iii) said polynucleotide is selected from the group consisting of SEQ ID no: 55-906, or (iv) said polynucleotide is selected from the group constituted by SEQ ID no: 907-1222, or ( v) said composition additionally comprises a DHPS-inhibiting herbicide or mitosis-inhibiting herbicide, preferably (a) said DHPS-inhibiting molecule is selected from the group consisting of carbamates and asulam, or (b) said molecule-inhibiting mitosis is selected from the group consisting of dinitroaniline herbicides, or (c) said composition additionally comprises a co-herbicide.
[5]
5. Method of reducing the expression of a DHPS gene in a plant characterized by the fact that it comprises: external application to a plant of a composition comprising a polynucleotide and a transfer agent, in which said polynucleotide is essentially identical or essentially complementary to a sequence of the DHPS gene, or to the RNA transcript of said sequence of the DHPS gene, wherein said sequence of the DHPS gene is selected from the group consisting of SEQ ID No.: 1-54 or a polynucleotide fragment of the same , from which said expression of said DHPS gene is reduced in relation to a plant in which the composition was not applied.
[6]
6. Method according to claim 5, characterized by the fact that (i) said transfer agent comprises an organosilicone compound, or (ii) said polynucleotide fragment is 19 contiguous nucleotides, 20 nucleotides contiguous or at least 21 nucleotides contiguous in length and at least 85 percent identical to a DHPS gene sequence selected from the group consisting of SEQ ID NO: 1-54, or (iii) said polynucleotide molecule is selected from the group consisting of ssSDNA or ssRNA sense or antisense, dsRNA, or dsDNA, or dsDNA / RNA hybrids.
[7]
7. Microbial expression cassette characterized by the fact that it comprises a polynucleotide fragment of 18 contiguous, 19 contiguous nucleotides, 20 contiguous nucleotides or at least 21 contiguous nucleotides in length and at least 85 percent identical to a sequence of the DHPS gene selected from the group consisting of SEQ ID No.: 1-54.
[8]
8. Method for making a polynucleotide characterized by the fact that it comprises a) transforming the microbial expression cassette as defined in claim 7 into a microbe; b) cultivate said microbe; c) collecting a polynucleotide from said microbe, wherein said polynucleotide is at least 18 contiguous, at least 19 contiguous nucleotides, at least 20 contiguous nucleotides or at least 21 contiguous nucleotides in length and at least 85 per percent identical to a DHPS gene sequence selected from the group consisting of SEQ ID No.: 1-54.
[9]
9. Method of identifying polynucleotides useful in modulating the expression of the DHPS gene when externally treating a plant characterized by the fact that it comprises: a) providing a plurality of polynucleotides that comprise an essentially identical or essentially complementary region to a fragment polynucleotide of 18 contiguous, 19 contiguous nucleotides, contiguous nucleotides or at least 21 contiguous nucleotides in length and at least 85 percent identical to a DHPS gene sequence selected from the group consisting of SEQ ID No.: 1-54; b) externally treating said plant with one or more of said polynucleotides and a transfer agent; c) analyze that plant or extract for modulation of the expression of the DHPS gene, and where a plant treated with that composition has its growth, development or reproductive capacity regulated, suppressed or delayed or that plant is more sensitive to an herbicide DHPS inhibitor or mitosis inhibitor herbicide as a result of said polynucleotide containing composition in relation to an untreated plant with said composition.
[10]
10. Method, according to claim 9, characterized by the fact that (i) said plant is selected from the group consisting of Amaranthus palmeri, Amaranthus rudis, Amaranthus hybridus, Amaranthus lividus, Amaranthus viridis, Ambrosia trifida, Conyza candensis, Digitaria sanguinalis, Euphorbia heterophylla, Kochia scoparia and Lolium multiflorum, or (ii) said DHPS gene expression is reduced in relation to a plant not treated with said polynucleotide fragment and a transfer agent , or (iii) said transfer agent is an organosilicone compound.
[11]
11. Agricultural chemical composition characterized by the fact that it comprises an admixture of a polynucleotide and a DHPS inhibitor or mitosis inhibitor herbicide and a co-herbicide, in which said polynucleotide is essentially identical or essential.
complementary to a portion of a DHPS gene sequence, or to a portion of an RNA transcript of said DHPS gene sequence, wherein said DHPS gene sequence is selected from the group consisting of SEQ ID no: 1-54 or a polynucleotide fragment thereof, and where a plant treated with that composition has its growth, development or reproductive capacity regulated, suppressed or delayed or that plant is more sensitive to a herbicide inhibitor of DHPS or mitosis inhibiting herbicide as a result of said composition containing polynucleotide in relation to an untreated plant with said composition.
[12]
12. Agricultural chemical composition, according to claim 11, characterized by the fact that said co-herbicide is selected from the group consisting of amide herbicides, arsenical herbicides, benzothiazole herbicides, benzoylcyclohexanedione herbicides, herbicides of benzofuranyl alkylsulfonate, cyclohexene oxime herbicides, cyclopropylisoxazole herbicides, dicarboximide herbicides, dinitroaniline herbicides, dinitrophenol herbicides, diphenyl ether herbicides, dithiocarbamate herbicides, glycine herbicides, halide herbicides, glycine herbicides, herbicides, glycine herbicides nitrile herbicides, organophosphorus herbicides, oxadiazolone herbicides, oxazole herbicides, phenoxy herbicides, phenylenediamine herbicides, pyrazole herbicides, pyridazine herbicides, pyridine herbicides, pyridine herbicides, pyridine herbicides, pyridine herbicides pyrimidinyloxybenzylamine, ammonium herbicides q uaternary, thiocarbamate herbicides, thiocarbonate herbicides, thiourea herbicides, triazine herbicides, triazinone herbicides, triazolone herbicides, triazolone herbicides, triazolopyrimidine herbicides, uracil herbicides, and uracil herbicides.
[13]
13. Agricultural chemical composition characterized by the fact that it comprises an admixture of a polynucleotide and a DHPS-inhibiting herbicide and a pesticide, wherein said polynucleotide is essentially identical or essentially complementary to a portion of a sequence of the DHPS gene or to a portion of an RNA transcript of said DHPS gene sequence, wherein said DHPS gene sequence is selected from the group consisting of SEQ ID NO: 1-54 or a polynucleotide fragment thereof, from which one field of plants grown in need of weed and pest control are treated with said composition and where a plant treated with that composition has its growth, development or reproductive capacity regulated, suppressed or delayed or that plant is more sensitive to a DHPS-inhibiting herbicide or mitosis-inhibiting herbicide as a result of said polynucleotide-containing composition in relation to a non-trafficking plant with that composition.
[14]
14. Agricultural chemical composition, according to claim 13, characterized by the fact that the aforementioned pesticide is selected from the group consisting of insecticides, fungicides, nematocides, bactericides, acaricides, growth regulators, chemosterilizers, semiochemicals , repellents, attractants, pheromones, food stimulants and biopesticides.
[15]
15. Composition characterized by the fact that it comprises a polynucleotide and a transfer agent, in which said polynucleotide is essentially identical or essentially complementary to a sequence of the DHPS gene or to an RNA transcript of said gene sequence DHPS, in which said polynucleotide is selected from the group consisting of SEQ ID nº: 1176 and 1186 or a complement or fragment of polynucleotide from it, and from where a plant treated with said composition has its capacity for growth or development or regulated, suppressed or delayed breeder or said plant is more sensitive to a DHPS-inhibiting herbicide or mitosis-inhibiting herbicide as a result of said polynucleotide-containing composition compared to an untreated plant with said composition.

类似技术:

---

公开号 | 公开日 | 专利标题

---

BR112014005954A2|2020-12-01|agricultural chemical methods and compositions for plant control, method of reducing the expression of a dhps gene in a plant, microbial expression cassette, method for making a polynucleotide, method of identifying polynucleotides useful in modulating expression of the dhps gene

---

US9416363B2|2016-08-16|Methods and compositions for weed control

---

EP2756084B1|2020-06-03|Methods and compositions for weed control

---

CN103930549B|2020-09-18|Methods and compositions for weed control

---

ES2645927T3|2017-12-11|Procedures and compositions for weed control

---

EP2756085B1|2019-03-20|Methods and compositions for weed control

---

US10808249B2|2020-10-20|Methods and compositions for weed control

---

BR112014005958A2|2020-10-13|agricultural chemical methods and compositions for plant control, method of reducing expression of an accase gene in a plant, microbial expression cassette, method for making a polynucleotide, method of identifying polynucleotides useful in modulating expression of the accase gene and herbicidal composition

---

US10760086B2|2020-09-01|Methods and compositions for weed control

同族专利:

---

公开号 | 公开日

---

WO2013040117A9|2013-06-06|

---

MX348495B|2017-06-14|

---

UA116092C2|2018-02-12|

---

UY34333A|2013-04-30|

---

EP3434779A1|2019-01-30|

---

EP2755987A4|2015-04-01|

---

EP2755987B1|2018-06-06|

---

AU2012308660B2|2017-05-25|

---

CN103958539A|2014-07-30|

---

MX2014003077A|2014-07-28|

---

US20130326731A1|2013-12-05|

---

AU2012308660A1|2014-04-03|

---

CA2848699A1|2013-03-21|

---

WO2013040117A1|2013-03-21|

---

EP2755987A1|2014-07-23|

---

AR087862A1|2014-04-23|

---

CN103958539B|2019-12-17|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US2171808A|1935-11-25|1939-09-05|Messerschmitt Boelkow Blohm|Vibration generator for test purposes|

---

US4535060A|1983-01-05|1985-08-13|Calgene, Inc.|Inhibition resistant 5-enolpyruvyl-3-phosphoshikimate synthetase, production and use|

---

US5304732A|1984-03-06|1994-04-19|Mgi Pharma, Inc.|Herbicide resistance in plants|

---

US4761373A|1984-03-06|1988-08-02|Molecular Genetics, Inc.|Herbicide resistance in plants|

---

DE3587548T2|1984-12-28|1993-12-23|Plant Genetic Systems Nv|Recombinant DNA that can be introduced into plant cells.|

---

NZ217113A|1985-08-07|1988-06-30|Monsanto Co|Production of eucaryotic plants which are glyphosate resistant, vectors , chimeric gene and plant cells|

---

US4940835A|1985-10-29|1990-07-10|Monsanto Company|Glyphosate-resistant plants|

---

US4810648A|1986-01-08|1989-03-07|Rhone Poulenc Agrochimie|Haloarylnitrile degrading gene, its use, and cells containing the gene|

---

ES2018274T5|1986-03-11|1996-12-16|Plant Genetic Systems Nv|VEGETABLE CELLS RESISTANT TO GLUTAMINE SYNTHETASE INHIBITORS, PREPARED BY GENETIC ENGINEERING.|

---

US5273894A|1986-08-23|1993-12-28|Hoechst Aktiengesellschaft|Phosphinothricin-resistance gene, and its use|

---

US5378824A|1986-08-26|1995-01-03|E. I. Du Pont De Nemours And Company|Nucleic acid fragment encoding herbicide resistant plant acetolactate synthase|

---

US5013659A|1987-07-27|1991-05-07|E. I. Du Pont De Nemours And Company|Nucleic acid fragment encoding herbicide resistant plant acetolactate synthase|

---

US5605011A|1986-08-26|1997-02-25|E. I. Du Pont De Nemours And Company|Nucleic acid fragment encoding herbicide resistant plant acetolactate synthase|

---

US5145783A|1987-05-26|1992-09-08|Monsanto Company|Glyphosate-tolerant 5-endolpyruvyl-3-phosphoshikimate synthase|

---

US4971908A|1987-05-26|1990-11-20|Monsanto Company|Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthase|

---

GB8825402D0|1988-10-31|1988-11-30|Cambridge Advanced Tech|Sulfonamide resistance genes|

---

US5550318A|1990-04-17|1996-08-27|Dekalb Genetics Corporation|Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof|

---

US5633435A|1990-08-31|1997-05-27|Monsanto Company|Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases|

---

US5866775A|1990-09-28|1999-02-02|Monsanto Company|Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthases|

---

FR2673642B1|1991-03-05|1994-08-12|Rhone Poulenc Agrochimie|CHIMERIC GENE COMPRISING A PROMOTER CAPABLE OF GIVING INCREASED TOLERANCE TO GLYPHOSATE.|

---

USRE36449E|1991-03-05|1999-12-14|Rhone-Poulenc Agro|Chimeric gene for the transformation of plants|

---

FR2673643B1|1991-03-05|1993-05-21|Rhone Poulenc Agrochimie|TRANSIT PEPTIDE FOR THE INSERTION OF A FOREIGN GENE INTO A PLANT GENE AND PLANTS TRANSFORMED USING THIS PEPTIDE.|

---

US5731180A|1991-07-31|1998-03-24|American Cyanamid Company|Imidazolinone resistant AHAS mutants|

---

JPH0557182A|1991-09-03|1993-03-09|Central Glass Co Ltd|Carbon dioxide absorbent|

---

US5339107A|1992-08-19|1994-08-16|Hewlett-Packard Company|Color optical scanner with rotating color filter assembly|

---

US5393175A|1993-06-18|1995-02-28|Courville; Leo|Diamond core drill|

---

US5767373A|1994-06-16|1998-06-16|Novartis Finance Corporation|Manipulation of protoporphyrinogen oxidase enzyme activity in eukaryotic organisms|

---

US5392910A|1994-07-21|1995-02-28|Transidyne General Corporation|Package for a device having a sharp cutting edge|

---

DE4430307A1|1994-08-26|1996-02-29|Bayer Ag|Method and device for the simultaneous dispersion and atomization of at least two liquids|

---

US5550398A|1994-10-31|1996-08-27|Texas Instruments Incorporated|Hermetic packaging with optical|

---

BR9604993B1|1995-04-20|2009-05-05|a mutant encoding a mutant ahas protein of acetohydroxy acid synthesis and mutant ahas proteins.|

---

US5853973A|1995-04-20|1998-12-29|American Cyanamid Company|Structure based designed herbicide resistant products|

---

FR2734842B1|1995-06-02|1998-02-27|Rhone Poulenc Agrochimie|DNA SEQUENCE OF A HYDROXY-PHENYL PYRUVATE DIOXYGENASE GENE AND OBTAINING PLANTS CONTAINING A HYDROXY-PHENYL PYRUVATE DIOXYGENASE GENE, TOLERANT TO CERTAIN HERBICIDES|

---

US5976567A|1995-06-07|1999-11-02|Inex Pharmaceuticals Corp.|Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer|

---

US5739180A|1996-05-02|1998-04-14|Lucent Technologies Inc.|Flat panel displays and methods and substrates therefor|

---

FR2751347B1|1996-07-16|2001-12-07|Rhone Poulenc Agrochimie|CHIMERIC GENE WITH MULTIPLE HERBICIDE TOLERANCE GENES, PLANT CELL AND PLANT TOLERANT WITH MULTIPLE HERBICIDES|

---

DE19652284A1|1996-12-16|1998-06-18|Hoechst Schering Agrevo Gmbh|Novel genes encoding amino acid deacetylases with specificity for N-acetyl-L-phosphinothricin, their isolation and use|

---

US7105724B2|1997-04-04|2006-09-12|Board Of Regents Of University Of Nebraska|Methods and materials for making and using transgenic dicamba-degrading organisms|

---

US6245968B1|1997-11-07|2001-06-12|Aventis Cropscience S.A.|Mutated hydroxyphenylpyruvate dioxygenase, DNA sequence and isolation of plants which contain such a gene and which are tolerant to herbicides|

---

US6069115A|1997-11-12|2000-05-30|Rhone-Poulenc Agrochimie|Method of controlling weeds in transgenic crops|

---

US6506559B1|1997-12-23|2003-01-14|Carnegie Institute Of Washington|Genetic inhibition by double-stranded RNA|

---

JP4036407B2|1997-12-26|2008-01-23|キヤノン株式会社|Inkjet printing apparatus and method|

---

US6121513A|1998-07-20|2000-09-19|Mendel Biotechnology, Inc.|Sulfonamide resistance in plants|

---

US6642435B1|1998-12-18|2003-11-04|E. I. Du Pont De Nemours And Company|Plant folate biosynthetic genes|

---

JP2000247810A|1999-02-26|2000-09-12|Meiji Seika Kaisha Ltd|Accelerator of pharmacological effect of agrochemical|

---

US6271359B1|1999-04-14|2001-08-07|Musc Foundation For Research Development|Tissue-specific and pathogen-specific toxic agents and ribozymes|

---

CN1373811A|1999-08-13|2002-10-09|辛根塔参与股份公司|Herbicide-tolerant protoporphyrinogen oxidase|

---

DE10000600A1|2000-01-10|2001-07-12|Bayer Ag|New N-substituted oxazolyl-uracil and thiazolyl-uracil derivatives useful as herbicides, especially for weed control in crops|

---

AU763213B2|2000-01-25|2003-07-17|Syngenta Participations Ag|3-phenoxy-1-phenyl acetylene derivatives and their use as herbicides|

---

DE10004084A1|2000-01-31|2001-08-02|Bayer Ag|Substituted imide derivatives|

---

AU2711401A|2000-01-31|2001-08-14|Nippon Soda Co|Substituted cyanoacetamide derivatives and herbicides|

---

JP2001253874A|2000-03-10|2001-09-18|Ishihara Sangyo Kaisha Ltd|Pyrimidine compound, their manufacturing method and herbicide including them|

---

US6444615B1|2000-04-18|2002-09-03|Dow Agrosciences Llc|Herbicidal imidazolidinetrione and thioxo-imidazolidinediones|

---

AT356812T|2000-05-19|2007-04-15|Basf Ag|METHOD FOR COMBATING UNWANTED PLANT GROWTH IN CEREALS|

---

DE10024938A1|2000-05-19|2001-11-22|Bayer Ag|New substituted iminoazine derivatives useful as herbicides, especially for weed control in crops|

---

JP2002080454A|2000-06-26|2002-03-19|Nippon Nohyaku Co Ltd|Pyridine-2,3-dicarboxylic acid diamide derivative and herbicide|

---

WO2002002540A1|2000-07-04|2002-01-10|Ube Industries, Ltd.|Benzoxazole compound, process for producing the same, and herbicide|

---

KR100392072B1|2000-09-07|2003-07-22|한국화학연구원|5-Benzyloxymethyl-1,2-isoxazoline Derivatives Which Possess Weeding Activity|

---

CA2422675A1|2000-10-03|2002-04-11|Syngenta Participations Ag|Phenylpropynyloxypyridine herbicides|

---

JP2002138075A|2000-10-30|2002-05-14|Nippon Soda Co Ltd|3-aminoacrylic acid derivative and herbicide|

---

EP1399566A2|2000-10-30|2004-03-24|Maxygen, Inc.|Novel glyphosate n-acetyltransferase genes|

---

FR2815969B1|2000-10-30|2004-12-10|Aventis Cropscience Sa|TOLERANT PLANTS WITH HERBICIDES BY METABOLIC BYPASS|

---

JP2002145707A|2000-11-10|2002-05-22|Sankyo Co Ltd|Herbicide comprising n-substituted dihydropyrrole derivative|

---

WO2002040473A1|2000-11-17|2002-05-23|Ishihara Sangyo Kaisha, Ltd.|Pyrimidine compounds or salts thereof, herbicides containing the compounds or the salts, methods for control of weeds by applying the same|

---

AU2002225656B2|2000-12-01|2006-01-12|E. I. Du Pont De Nemours And Company|Herbicidal heterocycles|

---

JP2002220389A|2001-01-26|2002-08-09|Hokko Chem Ind Co Ltd|Pyridylbenzoxazine derivative, herbicide and its intermediate|

---

EP1362059A2|2001-02-16|2003-11-19|Metanomics GmbH & Co. KGaA|Method for identifying herbicidally active substances|

---

EP1362852B1|2001-02-20|2011-04-06|Sagami Chemical Research Center|Pyrazole derivative, intermediate therefor, processes for producing these, and herbicide containing these as active ingredient|

---

EP1238586A1|2001-03-09|2002-09-11|Basf Aktiengesellschaft|Herbicidal 2-alkynyl-pyridines|

---

DE10116399A1|2001-04-03|2002-10-10|Bayer Ag|Substituted azolazine one|

---

US6743905B2|2001-04-16|2004-06-01|Applera Corporation|Mobility-modified nucleobase polymers and methods of using same|

---

JP2003064059A|2001-06-14|2003-03-05|Nippon Soda Co Ltd|Pyrimidine compound, method for producing the same and herbicide|

---

DE10130397A1|2001-06-23|2003-01-09|Bayer Cropscience Gmbh|Herbicidally substituted pyridines, processes for their preparation and their use as herbicides and plant growth regulators|

---

ITMI20011497A1|2001-07-13|2003-01-13|Isagro Ricerca Srl|NEW ANILINE DERIVATIVES SUBSTITUTED FOR HERBICIDE ACTIVITIES|

---

AR035087A1|2001-08-09|2004-04-14|Syngenta Participations Ag|PIRIDIL-ALQUINOS AND PIRIDIL-N-OXIDO-ACTIVE HERBICIDE ALKINES, PROCEDURE FOR PREPARATION, HERBICIDE COMPOSITION AND TO INHIBIT THE GROWTH OF PLANTS, METHOD FOR CONTROLLING GROWTH OF INDESEABLE PLANTS, AND METHOD OF CREAM INHIBITION|

---

US20040198758A1|2001-08-17|2004-10-07|Rapado Liliana Parra|N-heterocyclyl substituted thienyloxy-pyrimidines used as herbicides|

---

WO2003020704A1|2001-08-28|2003-03-13|Syngenta Participations Ag|Sulfonylamino derivatives useful as herbicides|

---

MXPA04001981A|2001-09-06|2004-06-07|Syngenta Participations Ag|Herbicidal n-alkylsulfonamino derivatives.|

---

US20040235667A1|2001-09-07|2004-11-25|Michael Hoffmann|Pyrazolyl-substituted thienyloxypyridines|

---

WO2003022831A1|2001-09-07|2003-03-20|Basf Aktiengesellschaft|4-alkyl-substitute thienyloxy-pyridines|

---

JP2003096059A|2001-09-21|2003-04-03|Otsuka Chem Co Ltd|Thiazole compound and herbicidal composition containing the same|

---

WO2003029243A2|2001-09-24|2003-04-10|Basf Aktiengesellschaft|2-aryloxy-6-pyrazolyl-pyridines|

---

US20050043180A1|2001-11-01|2005-02-24|Kim Dae Whang|Optically active herbicidal -phenoxypropionic acid-n-methyl-n-2-fluorophenyl amides|

---

DE10154075A1|2001-11-02|2003-05-15|Bayer Cropscience Ag|Substituted pyrimidines|

---

WO2003077648A2|2001-11-08|2003-09-25|Paradigm Genetics, Inc.|Methods for the identification of herbicides and the modulation of plant growth|

---

EP1451148A2|2001-11-29|2004-09-01|Basf Aktiengesellschaft|2,w-diaminocarboxylic acid compounds|

---

DE10256353A1|2001-12-06|2003-06-18|Syngenta Participations Ag|New 4-pyridylcarbonyl-cyclohexene-dione derivatives, useful as both total and selective herbicides and effective against mono- and di-cotyledonous weeds, for use on e.g. cereals, cotton, soya, sugar beet/cane and rape|

---

DE10256354A1|2001-12-06|2003-06-18|Syngenta Participations Ag|New 5-thiol-4-pyridylcarbonyl-cyclohexene-dione derivatives, useful as herbicides and plant growth inhibitors, with improved leaching properties and selectivity|

---

DE10256367A1|2001-12-06|2003-06-26|Syngenta Participations Ag|New 4--cyclohex-4-ene-1,3-dione derivatives, useful as herbicides and plant growth inhibitors, especially for selective weed control in crops such as cereals, cotton or soya|

---

AR037754A1|2001-12-11|2004-12-01|Syngenta Participations Ag|HERBICIDES|

---

DE10161765A1|2001-12-15|2003-07-03|Bayer Cropscience Gmbh|Substituted phenyl derivatives|

---

AT458717T|2001-12-19|2010-03-15|Basf Se|BETA-AMINO-ALPHA-CYANOACRYLATES AND THEIR USE AS HERBICIDES|

---

JP4459624B2|2001-12-19|2010-04-28|ビーエーエスエフソシエタス・ヨーロピア|α-Cyanoacrylate|

---

DE10204951A1|2002-02-06|2003-08-14|Basf Ag|Phenylalanine derivatives as herbicides|

---

AU2003218758A1|2002-03-14|2003-09-22|Syngenta Participations Ag|Derivatives of 1-phenyl-3-phenylpyrazole as herbicides|

---

AR039208A1|2002-04-03|2005-02-09|Syngenta Participations Ag|PHENYL AND PIRIDYL ALKIN COMPOUNDS, HERBICIDE COMPOSITION CONTAINING THEM, PROCEDURE FOR PREPARATION OF THOSE AND PROCEDURE TO COMBAT THE GROWTH OF INDENATED PLANTS|

---

PL373888A1|2002-04-25|2005-09-19|Basf Aktiengesellschaft|3-heteroaryl substituted 5-methyloxymethyl isoxazolines used as herbicides|

---

WO2003091217A1|2002-04-26|2003-11-06|Ishihara Sangyo Kaisha, Ltd.|Pyridine compounds or salts thereof and herbicides containing the same|

---

DE10219435A1|2002-05-02|2003-11-13|Bayer Cropscience Ag|Substituted pyrazolo-pyrimidin-4-ones|

---

JP2004051628A|2002-05-28|2004-02-19|Ishihara Sangyo Kaisha Ltd|Pyridine-based compound or its salt, method for producing the same, and herbicide containing the same|

---

AR040413A1|2002-05-31|2005-04-06|Syngenta Participations Ag|HETEROCICLILALQUINOS ACTIVE AS HERBICIDES|

---

AR041182A1|2002-07-01|2005-05-04|Syngenta Participations Ag|DERIVATIVES OF PHENOXIPROPENYLPHENYL AND ITS USE AS HERBICIDES|

---

AR041181A1|2002-07-01|2005-05-04|Syngenta Participations Ag|HERBICIDE TENYLALKINS AND PROCEDURE FOR PREPARING SUCH COMPOUNDS|

---

DE10234876A1|2002-07-25|2004-02-05|Bayer Cropscience Gmbh|4-trifluoromethylpyrazolyl substituted pyridines and pyrimidines|

---

DE10234875A1|2002-07-25|2004-02-05|Bayer Cropscience Gmbh|4-trifluoromethylpyrazolyl substituted pyridines and pyrimidines|

---

AU2003252259A1|2002-07-26|2004-02-16|Nihon Nohyaku Co., Ltd.|Novel haloalkylsulfonanilide derivatives, herbicides and usage thereof|

---

FR2844415B1|2002-09-05|2005-02-11|At & T Corp|FIREWALL SYSTEM FOR INTERCONNECTING TWO IP NETWORKS MANAGED BY TWO DIFFERENT ADMINISTRATIVE ENTITIES|

---

JP2004107228A|2002-09-17|2004-04-08|Nippon Nohyaku Co Ltd|Bicyclic pyrimidinone derivative and herbicide comprising the same as active ingredient|

---

TW200410975A|2002-09-26|2004-07-01|Nihon Nohyaku Co Ltd|New pesticide and method for using it, new substituted thienopyrimidine derivative, its intermediate, and method for producing it|

---

WO2004035563A1|2002-10-17|2004-04-29|Syngenta Participations Ag|3-heterocyclylpyridine derivatives useful as herbicides|

---

WO2004035564A1|2002-10-17|2004-04-29|Syngenta Participations Ag|Pyridine derivatives useful as herbicides|

---

WO2004035545A2|2002-10-18|2004-04-29|E.I. Du Pont De Nemours And Company|Azolecarboxamide herbicides|

---

JP4398866B2|2002-10-18|2010-01-13|ビーエーエスエフソシエタス・ヨーロピア|1-phenylpyrrolidin-2-one-3-carboxamide|

---

JP2006507841A|2002-11-14|2006-03-09|ダーマコン，インコーポレイテッド|Functional and ultrafunctional siRNA|

---

US20040133944A1|2003-01-08|2004-07-08|Delta And Pine Land Company|Seed oil suppression to enhance yield of commercially important macromolecules|

---

CN1521165A|2003-01-30|2004-08-18|拜尔农作物科学股份公司|Thiophene derivative|

---

DE10303883A1|2003-01-31|2004-08-12|Bayer Cropscience Ag|Substituted pyrimidines|

---

CN1526704A|2003-03-06|2004-09-08|拜尔农作物科学股份公司|Substituted triazolformamide compound|

---

JP2005008583A|2003-06-20|2005-01-13|Nippon Soda Co Ltd|Guanidine compound, herbicide and plant growth regulator|

---

JP2005015390A|2003-06-26|2005-01-20|Bayer Cropscience Ag|Azolidine derivative and herbicide|

---

WO2005017108A2|2003-06-30|2005-02-24|United Soybean Board|Soybean selection system based on aec-resistance|

---

CN1208325C|2003-07-04|2005-06-29|中国科学院上海有机化学研究所|2-pyrimidine oxy-N-ureido phenyl-benzyl amide compound, preparing method and use thereof|

---

WO2005007627A1|2003-07-18|2005-01-27|Nihon Nohyaku Co., Ltd.|Phenylpyridine derivative, intermediate therefor, and herbicide containing the same as active ingredient|

---

WO2005040152A1|2003-10-20|2005-05-06|E.I. Dupont De Nemours And Company|Heteroyclylphenyl-and heterocyclylpyridyl-substituted azolecarboxamides as herbicides|

---

WO2005047233A1|2003-10-31|2005-05-26|Syngenta Participations Ag|Novel herbicides|

---

WO2005047281A1|2003-11-13|2005-05-26|Syngenta Participations Ag|Novel herbicides|

---

CA2548442A1|2003-12-19|2005-07-07|Basf Aktiengesellschaft|Benzoyl-substituted phenylalanine amides|

---

US20070060480A1|2003-12-19|2007-03-15|Matthias Witschel|Heteroaroyl-substituted phenylalanineamides|

---

WO2005070889A1|2004-01-23|2005-08-04|E.I. Dupont De Nemours And Company|Herbicidal amides|

---

JP4596795B2|2004-02-27|2010-12-15|住友林業株式会社|Plant inhibitor containing piperitol or its derivatives as active ingredients|

---

DE102004011705A1|2004-03-10|2005-09-29|Bayer Cropscience Gmbh|Substituted 4- -pyrimidines|

---

JP2005314407A|2004-03-31|2005-11-10|Nippon Nohyaku Co Ltd|New haloalkylsulfonanilide derivative, herbicide, method for using the same and intermediate therefor|

---

WO2005095335A1|2004-03-31|2005-10-13|Kureha Corporation|Ylide compounds, process for production of the same, and use thereof as herbicide and intermediates of drugs|

---

BRPI0509460B8|2004-04-30|2017-06-20|Dow Agrosciences Llc|herbicide resistance genes|

---

WO2006006569A1|2004-07-12|2006-01-19|Nihon Nohyaku Co., Ltd.|Phenylpyridine derivative or salt thereof, herbicide containing the same as active ingredient, and method of use thereof|

---

CA2577495C|2004-09-03|2013-08-06|Syngenta Limited|Isoxazoline derivatives and their use as herbicides|

---

US20080103049A1|2004-09-16|2008-05-01|Bsdg Aktiengesellschaft|Benzoyl-Substituted Serineamides|

---

MX2007001836A|2004-09-16|2007-04-23|Basf Ag|Heteroaroyl-substituted serine amides utilized as herbicides.|

---

PL1799657T3|2004-10-05|2010-05-31|Syngenta Ltd|Isoxazoline derivatives and their use as herbicides|

---

DE102004054665A1|2004-11-12|2006-05-18|Bayer Cropscience Gmbh|Substituted bicyclic and tricyclic pyrazole derivatives Methods for the preparation and use as herbicides and plant growth regulators|

---

DE102004054666A1|2004-11-12|2006-05-18|Bayer Cropscience Gmbh|New substituted pyrazol-3-carboxamide derivatives useful to combat harmful plants and for growth regulation of plants|

---

CA2527439C|2004-11-19|2013-10-01|Dow Agrosciences Llc|Methylidene mevalonates and their use as herbicides|

---

JP2006232824A|2005-01-27|2006-09-07|Sagami Chem Res Center|Imidazole derivative, method for producing the same and herbicide comprising the same as active ingredient|

---

ZA200707119B|2005-02-24|2009-09-30|Nihon Nohyaku Co Ltd|Novel haloalkylsulfonanilide derivative, herbicide, and method of use thereof|

---

DE102005014638A1|2005-03-31|2006-10-05|Bayer Cropscience Gmbh|Substituted pyrazolyloxyphenyl derivatives as herbicides|

---

JP2006282552A|2005-03-31|2006-10-19|Nippon Nohyaku Co Ltd|Phenylheteroaryls or their salts and herbicide comprising the same as active ingredient|

---

DE102005014906A1|2005-04-02|2006-10-05|Bayer Cropscience Gmbh|New pyrimidine compounds e.g. N- pyridine-4-yl)oxy) pyrimidine-2-yl)methyl) cyclopropane carboxamide useful for combating weeds|

---

GB0510151D0|2005-05-18|2005-06-22|Syngenta Ltd|Novel herbicides|

---

EP1888532A1|2005-05-25|2008-02-20|Basf Aktiengesellschaft|Heteroaroyl-substituted serine amides|

---

EA013646B1|2005-05-25|2010-06-30|Басф Акциенгезельшафт|Benzoyl-substituted serine amides|

---

DE102005031412A1|2005-07-06|2007-01-11|Bayer Cropscience Gmbh|3- [1-Halo-1-aryl-methane-sulfonyl] and 3- [1-halo-1-heteroaryl-methanesulfonyl] -isoxazoline derivatives, processes for their preparation and use as herbicides and plant growth regulators|

---

JPWO2007026834A1|2005-09-01|2009-03-12|クミアイ化学工業株式会社|Pyrazole derivatives and herbicides for agriculture and horticulture|

---

EP1931789B1|2005-09-20|2016-05-04|BASF Plant Science GmbH|Methods for controlling gene expression using ta-siran|

---

JP2007161701A|2005-11-15|2007-06-28|Hokko Chem Ind Co Ltd|Aryloxy-n-alkanoic acid amino derivative and use|

---

JP2007153847A|2005-12-08|2007-06-21|Hokko Chem Ind Co Ltd|Phenoxyalkanoic acid amide derivative and herbicide|

---

GB0526044D0|2005-12-21|2006-02-01|Syngenta Ltd|Novel herbicides|

---

EP1976383A2|2005-12-23|2008-10-08|Basf Se|A method for controlling aquatic weeds|

---

AR058408A1|2006-01-02|2008-01-30|Basf Ag|PIPERAZINE COMPOUNDS WITH HERBICITY ACTION|

---

PE20071051A1|2006-01-05|2007-11-29|Basf Ag|PIPERAZINE COMPOUNDS WITH HERBICIDAL ACTION|

---

JP2007182404A|2006-01-10|2007-07-19|Hokko Chem Ind Co Ltd|Aryloxy-n-alkanoic acid amide derivative and herbicide|

---

EP1987015A2|2006-02-16|2008-11-05|Basf Se|Benzoyl-substituted alanines|

---

BRPI0707907A2|2006-02-16|2011-05-17|Basf Se|compound, process for preparing a compound, agent, processes for preparing agents, and for combating unwanted vegetation, and use of compounds|

---

GB0603891D0|2006-02-27|2006-04-05|Syngenta Ltd|Novel herbicides|

---

TWI375669B|2006-03-17|2012-11-01|Sumitomo Chemical Co|Pyridazinone compound and use thereof|

---

JP2009537477A|2006-05-19|2009-10-29|ビーエーエスエフソシエタス・ヨーロピア|Benzoyl-substituted alanine|

---

EP2027095A1|2006-05-19|2009-02-25|Basf Se|Heteroaroyl-substituted alanines with a herbicidal action|

---

GB0614471D0|2006-07-20|2006-08-30|Syngenta Ltd|Herbicidal Compounds|

---

JP2008074840A|2006-08-23|2008-04-03|Nippon Nohyaku Co Ltd|Novel haloalkylsulfonanilide derivative, herbicide, and method of using the same|

---

JP2008074841A|2006-08-23|2008-04-03|Nippon Nohyaku Co Ltd|Novel haloalkylsulfonanilide derivative, herbicide and method of using the same|

---

GB0617575D0|2006-09-06|2006-10-18|Syngenta Ltd|Herbicidal compounds and compositions|

---

TW200829171A|2006-11-17|2008-07-16|Nihon Nohyaku Co Ltd|Haloalkyl sulfonanilide derivatives or salts thereof, herbicide using it as effective constituent and use-method thereof|

---

JP2008133218A|2006-11-28|2008-06-12|Hokko Chem Ind Co Ltd|Phenoxy butyric acid amide derivative and herbicide|

---

JP2008133207A|2006-11-28|2008-06-12|Hokko Chem Ind Co Ltd|Oxazolinone derivative, method for producing the same and herbicide|

---

GB0624760D0|2006-12-12|2007-01-17|Syngenta Ltd|Herbicidal compounds|

---

GB0625598D0|2006-12-21|2007-01-31|Syngenta Ltd|Novel herbicides|

---

JP2008169121A|2007-01-09|2008-07-24|Bayer Cropscience Ag|Jasmonic acid derivative, herbicide and herbicidal effect-reinforcing agent|

---

EA200900918A1|2007-01-11|2009-12-30|Басф Се|Hetero-Aryl Substituted Serinamides|

---

CL2008000376A1|2007-02-09|2008-08-18|Du Pont|COMPOUNDS DERIVED FROM PIRIDINE N-OXIDES; HERBICIDE COMPOSITION; AND METHOD TO CONTROL THE GROWTH OF INDESEATED VEGETATION.|

---

WO2008102908A1|2007-02-23|2008-08-28|Nissan Chemical Industries, Ltd.|Haloalkylsulfonanilide derivative|

---

DE102007012168A1|2007-03-12|2008-09-18|Bayer Cropscience Ag|New thiazole derivatives useful as herbicides and plant growth regulators|

---

CN101279951B|2007-04-06|2010-09-01|中国中化股份有限公司|2-pyrimindinyloxy benzoxy enoates compound and application thereof|

---

CN101279950B|2007-04-06|2010-08-11|中国中化股份有限公司|2-pyrimindinyloxy benzoxy acetamide compound and application thereof|

---

EP1997381A1|2007-06-01|2008-12-03|Commissariat à l'Energie Atomique|Use of a compound having a monogalactosyldiacylglycerol synthase inhibitory activity as herbicide or algaecide, herbicide and algaecide compositions|

---

MX2009013325A|2007-06-07|2010-05-20|Ca Minister Agriculture & Food|Nanocarrier based plant transfection and transduction.|

---

EP2054395A2|2007-06-12|2009-05-06|Basf Se|Piperazine compounds with a herbicidal action|

---

DE502008000206D1|2007-06-12|2009-12-31|Basf Se|PIPERAZIN COMPOUNDS WITH HERBICIDAL EFFECT|

---

MX2009011451A|2007-06-22|2009-11-10|Basf Se|Piperazine compounds with herbicidal action.|

---

KR100884933B1|2007-07-03|2009-02-23|주식회사경농|Optically active r-aryloxypropionic acid amides and herbicidal compositions comprising same|

---

CL2008002703A1|2007-09-14|2009-11-20|Sumitomo Chemical Co|Compounds derived from 1,4-dihydro-2h-pyridazin-3-one; herbicidal composition comprising said compounds; weed control method; use of said compounds for weed control; and intermediate compounds.|

---

JP2009067739A|2007-09-14|2009-04-02|Sumitomo Chemical Co Ltd|Herbicidal composition|

---

EP2212420A2|2007-11-05|2010-08-04|Baltic Technology Development, Ltd.|Use of oligonucleotides with modified bases as antiviral agents|

---

JP2009114128A|2007-11-07|2009-05-28|Hokko Chem Ind Co Ltd|Amide derivative of amino acid and herbicide|

---

GB0722472D0|2007-11-15|2007-12-27|Syngenta Ltd|Herbicidal compounds|

---

JP2009126792A|2007-11-20|2009-06-11|Sagami Chem Res Center|5-substituted phenyl-2-trifluoromethylpyrimidin-6-one derivative, method for producing the same and herbicide containing the derivative as active ingredient|

---

EP2065373A1|2007-11-30|2009-06-03|Bayer CropScience AG|Chiral 3--5,5-dimethyl-4,5-dihydroisoxazole and 5,5-dimethyl-3-[ sulfinyl]-4,5-dihydroisoxazole derivatives, methods for their preparation and their use as herbicides and plant growth regulators|

---

EP2065374A1|2007-11-30|2009-06-03|Bayer CropScience AG|2-sulfinyl-thiazol-derivatives as herbicides and plant growth regulators|

---

JP2009137851A|2007-12-04|2009-06-25|Sagami Chem Res Center|2-trifluoromethylpyrimidin-6-one derivative, method for producing the same, and herbicide comprising the derivative as active ingredient|

---

CL2008003785A1|2007-12-21|2009-10-09|Du Pont|Pyridazine derived compounds; herbicidal compositions comprising said compounds; and method of controlling the growth of unwanted vegetation.|

---

GB0800856D0|2008-01-17|2008-02-27|Syngenta Ltd|Herbicidal compounds|

---

GB0800855D0|2008-01-17|2008-02-27|Syngenta Ltd|Herbicidal compounds|

---

WO2009110924A1|2008-03-03|2009-09-11|Ms Technologies Llc|Antibodies immunoreactive with mutant 5-enolpyruvlshikimate-3-phosphate synthase|

---

WO2009116151A1|2008-03-19|2009-09-24|アグロカネショウ株式会社|1-phenyl-5-difluoromethylpyrazole-4-carboxamide derivatives and herbicides containing the derivatives as the active ingredient|

---

GB0805318D0|2008-03-20|2008-04-30|Syngenta Ltd|Herbicidal compounds|

---

EP2135865A1|2008-06-17|2009-12-23|Bayer CropScience AG|Substituted 1-pyrazol-4-yl acetic acids, method for their production and their use as herbicides and plant growth regulators|

---

WO2009158258A1|2008-06-25|2009-12-30|E. I. Du Pont De Nemours And Company|Herbicidal dihydro oxo six-membered azinyl isoxazolines|

---

TWI455944B|2008-07-01|2014-10-11|Daiichi Sankyo Co Ltd|Double-stranded polynucleotides|

---

ES2566008T3|2008-07-10|2016-04-08|Regenesance B.V.|Complement antagonists and uses thereof|

---

EP2147919A1|2008-07-24|2010-01-27|Bayer CropScience Aktiengesellschaft|Heterocyclic substituted amides, method for their manufacture and their use as herbicides|

---

EP2315760B1|2008-07-29|2013-03-06|Basf Se|Piperazine compounds with herbicidal effect|

---

EP2484666A1|2008-08-15|2012-08-08|Georgetown University|Fluorescent regulators of RASSF1A expression and human cancer cell proliferation|

---

KR101667063B1|2008-09-02|2016-10-17|닛산 가가쿠 고교 가부시키 가이샤|Ortho-substituted haloalkylsulfonanilide derivative and herbicide|

---

WO2010034153A1|2008-09-25|2010-04-01|沈阳化工研究院|New 2-pyrimidinyloxy benzoxy olefin acid ester compounds and uses thereof|

---

US20100099561A1|2008-10-15|2010-04-22|E.I. Du Pont De Nemours And Company|Heterobicyclic alkylthio-bridged isoxazolines|

---

AU2009309837A1|2008-10-29|2010-05-06|Basf Se|Substituted pyridines having a herbicidal effect|

---

BRPI0914348A2|2008-10-31|2015-08-11|Basf Se|Method for improving the health of a cultivated plant, uses at least one compost, fruit and seed.|

---

US20110207609A1|2008-10-31|2011-08-25|Basf Se|Piperazine Compounds With Herbicidal Effect|

---

CA2740335A1|2008-10-31|2010-05-06|Basf Se|Method for improving plant health|

---

EP2194052A1|2008-12-06|2010-06-09|Bayer CropScience AG|Substituted 1.- and 1-pyrazol-4-yl acetic acids, method for their production and their use as herbicides and plant growth regulators|

---

DE102008063561A1|2008-12-18|2010-08-19|Bayer Cropscience Ag|Hydrazides, process for their preparation and their use as herbicides and insecticides|

---

WO2010069802A1|2008-12-18|2010-06-24|Basf Se|Heterocyclic diketone derivatives with herbicidal action|

---

EP2204366A1|2008-12-19|2010-07-07|Bayer CropScience AG|Herbicidal and insecticidal phenyl-substituted pyridazinones|

---

JP2010235603A|2009-03-13|2010-10-21|Sumitomo Chemical Co Ltd|Pyridazinone compound and use thereof|

---

EP2229813A1|2009-03-21|2010-09-22|Bayer CropScience AG|Pyrimidine-4-ylpropandinitrile derivatives, method for their manufacture and their use as herbicides and plant growth regulators|

---

GB0905441D0|2009-03-30|2009-05-13|Syngenta Ltd|Herbicidal compounds|

---

WO2010116122A2|2009-04-06|2010-10-14|Syngenta Limited|Herbicidal compounds|

---

US20120029187A1|2009-04-14|2012-02-02|Nissan Chemical Industries, Ltd.|Haloalkylsulfonanilide derivative|

---

GB0908293D0|2009-05-14|2009-06-24|Syngenta Ltd|Herbicidal compounds|

---

WO2011003776A2|2009-07-09|2011-01-13|Basf Se|Substituted cyanobutyrates having a herbicidal effect|

---

AU2010297635B2|2009-09-25|2015-05-07|Bayer Intellectual Property Gmbh|N- benzamides and the use thereof as herbicides|

---

DE102010042866A1|2009-10-30|2011-05-05|Basf Se|New thioamide compounds, useful for controlling undesirable plant growth or weeds in cultural plants e.g. Arachis hypogaea, Allium cepa, Elaeis guineensis and Gossypium herbaceum|

---

US8329619B2|2009-11-03|2012-12-11|Basf Se|Substituted quinolinones having herbicidal action|

---

US9145562B2|2009-11-20|2015-09-29|Alberta Innovates—Technology Futures|Variegation in plants|

---

JP2011195561A|2009-11-24|2011-10-06|Sumitomo Chemical Co Ltd|Ketone compound, and herbicide comprising the same|

---

EA201290559A1|2009-12-23|2013-01-30|Байер Интеллектуэль Проперти Гмбх|PLANTS RESISTANT TO HERBICIDES - HPPD INHIBITORS|

---

BR112012022570A2|2010-03-08|2015-10-06|Monsato Technology Llc|polynucleotide molecules for gene regulation in plants.|US8097712B2|2007-11-07|2012-01-17|Beelogics Inc.|Compositions for conferring tolerance to viral disease in social insects, and the use thereof|

---

US8962584B2|2009-10-14|2015-02-24|Yissum Research Development Company Of The Hebrew University Of Jerusalem, Ltd.|Compositions for controlling Varroa mites in bees|

---

BR112012022570A2|2010-03-08|2015-10-06|Monsato Technology Llc|polynucleotide molecules for gene regulation in plants.|

---

US10829828B2|2011-09-13|2020-11-10|Monsanto Technology Llc|Methods and compositions for weed control|

---

US10806146B2|2011-09-13|2020-10-20|Monsanto Technology Llc|Methods and compositions for weed control|

---

UA115535C2|2011-09-13|2017-11-27|Монсанто Текнолоджи Ллс|Methods and compositions for weed control|

---

WO2013040033A1|2011-09-13|2013-03-21|Monsanto Technology Llc|Methods and compositions for weed control|

---

UA116089C2|2011-09-13|2018-02-12|Монсанто Текнолоджи Ллс|Methods and compositios for weed control|

---

US9840715B1|2011-09-13|2017-12-12|Monsanto Technology Llc|Methods and compositions for delaying senescence and improving disease tolerance and yield in plants|

---

CA2848695A1|2011-09-13|2013-03-21|Monsanto Technology Llc|Methods and composition for weed control comprising inhibiting ppg oxidase|

---

US10760086B2|2011-09-13|2020-09-01|Monsanto Technology Llc|Methods and compositions for weed control|

---

US9920326B1|2011-09-14|2018-03-20|Monsanto Technology Llc|Methods and compositions for increasing invertase activity in plants|

---

US10240161B2|2012-05-24|2019-03-26|A.B. Seeds Ltd.|Compositions and methods for silencing gene expression|

---

EP2908620A4|2012-10-18|2016-07-27|Monsanto Technology Llc|Methods and compositions for plant pest control|

---

US10041068B2|2013-01-01|2018-08-07|A. B. Seeds Ltd.|Isolated dsRNA molecules and methods of using same for silencing target molecules of interest|

---

US10683505B2|2013-01-01|2020-06-16|Monsanto Technology Llc|Methods of introducing dsRNA to plant seeds for modulating gene expression|

---

US10000767B2|2013-01-28|2018-06-19|Monsanto Technology Llc|Methods and compositions for plant pest control|

---

CA2905104A1|2013-03-13|2014-10-09|Monsanto Technology Llc|Control of lolium species by topical application of herbicidal composition comprising dsrna|

---

EP2971185A4|2013-03-13|2017-03-08|Monsanto Technology LLC|Methods and compositions for weed control|

---

US20140283211A1|2013-03-14|2014-09-18|Monsanto Technology Llc|Methods and Compositions for Plant Pest Control|

---

US10568328B2|2013-03-15|2020-02-25|Monsanto Technology Llc|Methods and compositions for weed control|

---

US9909132B2|2013-04-09|2018-03-06|Chris Tuttle|Formulations and methods for control of weedy species|

---

CA2918387C|2013-07-19|2021-11-02|Monsanto Technology Llc|Compositions and methods for controlling leptinotarsa|

---

US9850496B2|2013-07-19|2017-12-26|Monsanto Technology Llc|Compositions and methods for controlling Leptinotarsa|

---

AR098295A1|2013-11-04|2016-05-26|Monsanto Technology Llc|COMPOSITIONS AND METHODS TO CONTROL INFESTATIONS OF PESTS AND PARASITES OF THE ARTHROPODS|

---

WO2015089078A1|2013-12-10|2015-06-18|Beeologics, Inc.|Compositions and methods for virus control in varroa mite and bees|

---

EP3116303B1|2014-01-15|2020-07-22|Monsanto Technology LLC|Methods and compositions for weed control using epsps polynucleotides|

---

US11091770B2|2014-04-01|2021-08-17|Monsanto Technology Llc|Compositions and methods for controlling insect pests|

---

US10988764B2|2014-06-23|2021-04-27|Monsanto Technology Llc|Compositions and methods for regulating gene expression via RNA interference|

---

RU2021123470A|2014-07-29|2021-09-06|Монсанто Текнолоджи Ллс|COMPOSITIONS AND METHODS FOR COMBATING PESTS|

---

EP3256589B1|2015-01-22|2021-12-22|Monsanto Technology LLC|Compositions and methods for controlling leptinotarsa|

---

CN107750125A|2015-06-02|2018-03-02|孟山都技术有限公司|For by the composition and method in delivery of polynucleotides to plant|

---

EP3302030A4|2015-06-03|2019-04-24|Monsanto Technology LLC|Methods and compositions for introducing nucleic acids into plants|

法律状态:
2020-12-15| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|

---

2020-12-22| B06U| Preliminary requirement: requests with searches performed by other patent offices: procedure suspended [chapter 6.21 patent gazette]|

---

2021-04-13| B11B| Dismissal acc. art. 36, par 1 of ipl - no reply within 90 days to fullfil the necessary requirements|

---

2021-12-07| B350| Update of information on the portal [chapter 15.35 patent gazette]|

优先权:

---

申请号 | 申请日 | 专利标题

---

US201161534097P| true| 2011-09-13|2011-09-13|

---

US61/534,097|2011-09-13|

---

PCT/US2012/054980|WO2013040117A1|2011-09-13|2012-09-13|Methods and compositions for weed control|

---